dgcW

dgcW
168

diguanylate cyclase and potential phosphodiesterase

locus
BSU_13420
Molecular weight
84.63 kDa
pI
6.82
Protein length
Gene length
function
synthesis of c-di-GMP
product
diguanylate cyclase and potential phosphodiesterase
essential
no
synonyms
dgcW, ykoW

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG3300

This gene is a member of the following regulons

Gene
Coordinates
1,407,329  1,409,578
The protein
Catalyzed reaction/ biological activity
synthesis of c-di-GMP from two molecules of GTP [Pubmed|23893111]
[wiki|Domains]
MHYT domain (aa 7-201) (according to UniProt)
contains a N-terminal [wiki|PAS domain] [Pubmed|23893111]
contains a central [wiki|GGDEF domain] and a C-terminal [wiki|EAL domain] [Pubmed|22821967]
aa 290-735 are similar to ''E.  coli'' CsrD (18% identity, 43% similarity)
Structure
[PDB|5XGB] (from Pseudomonas aeruginosa, corresponds to the C-terminal part of DgcW, aa 194 ... 735, 29% identity) [pubmed|29109186]
[AF|O34311]
[wiki|Localization]
cell membrane (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|A2E6852A5739B3C04405B98AFFC301A98E1ADCD0|dgcW]
description
[Pubmed|22383849]
sigma factors
[protein|7024E4162A6D827069F882FDEACA696EBC05DD40|sigD]: sigma factor, [Pubmed|26577401], in [regulon|protein:7024E4162A6D827069F882FDEACA696EBC05DD40|sigD regulon]
Open in new tab

[gene|A2E6852A5739B3C04405B98AFFC301A98E1ADCD0|dgcW]

2022-12-01 07:58:47

ghost

15

3e750b0ff0745774be04b232f89ddb7bd76cf215

D6074E82B5ABD2EBA34CE3DEF4860CF155B238CC

Biological materials
Mutant
MGNA-B314 (ykoW::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1313 NBRP B. subtilis, Japan]
GP850 (''[gene|A2E6852A5739B3C04405B98AFFC301A98E1ADCD0|dgcW]''::''cat''), available in [wiki|Jörg Stülke]'s lab [pubmed|28420751]
BP140 (''[gene|A2E6852A5739B3C04405B98AFFC301A98E1ADCD0|dgcW]''::''ermC'') available in [wiki|Fabian Commichau]'s lab
BP142 (''[gene|A2E6852A5739B3C04405B98AFFC301A98E1ADCD0|dgcW]-[gene|B3E1652E9F3BDC9520847C479A2C0BED25025B4C|ykoV]-[gene|127CB0930A2D96B18D9261180028818F158C68CB|ligD]''::''kan'') available in [wiki|Fabian Commichau]'s lab
BKE13420 ([gene|A2E6852A5739B3C04405B98AFFC301A98E1ADCD0|dgcW]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE13420 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAATGGAGATTCCCCCCGT,  downstream forward: _UP4_TAACAGCGCCGGCTTTTTTT
BKK13420 ([gene|A2E6852A5739B3C04405B98AFFC301A98E1ADCD0|dgcW]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK13420 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAATGGAGATTCCCCCCGT,  downstream forward: _UP4_TAACAGCGCCGGCTTTTTTT
two-hybrid system
B. pertussis adenylate cyclase-based bacterial two hybrid system ([wiki|BACTH]), available in [wiki|Jörg Stülke]'s lab
References
11728710,16980588,22821967,22383849,23893111,26577401,29109186

A2E6852A5739B3C04405B98AFFC301A98E1ADCD0

Page visits: 2573

Time of last update: 2022-12-04 04:02:51

Author of last update: Melvin.boenninger