mpr

mpr
168

extracellular metalloprotease

locus
BSU_02240
Molecular weight
33.69 kDa
pI
8.97
Protein length
Gene length
function
protein degradation
product
extracellular metalloprotease
essential
no
synonyms
mpr

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG3591

This gene is a member of the following regulons

Gene
Coordinates
245,190  246,131
The protein
Protein family
peptidase S1B family (single member, according to UniProt)
Structure
[PDB|1P3C] (from B. intermedius, corresponds to aa 95 ... 289, 31% identity) [pubmed|15005613]
[AF|P39790]
[wiki|Localization]
extracellular (signal peptide) [Pubmed|18957862]
Expression and Regulation
Operons
genes
[gene|A39D349BBE13F4F3F6D33DA72CB8149A5170255C|mpr]-[gene|22A5905A0C2A9303C166A5C2D784AF0B6541A311|ybfJ]
description
[Pubmed|12107147]
regulation
repressed by casamino acids [Pubmed|12107147]
regulatory mechanism
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, [Pubmed|25666135], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
Open in new tab

[gene|A39D349BBE13F4F3F6D33DA72CB8149A5170255C|mpr]→[gene|22A5905A0C2A9303C166A5C2D784AF0B6541A311|ybfJ]

2022-09-26 00:11:56

ghost

23

c94f708bb33d19ebb7718a8e2cca7da24f7d075f

F0A001416ED39498CAC09F0DF093E069C2540398

Biological materials
Mutant
KO7 (''nprE  aprE  epr  mpr  nprB  vpr  bpr''), available as BGSC 1A1133
BKE02240 ([gene|A39D349BBE13F4F3F6D33DA72CB8149A5170255C|mpr]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE02240 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTGTCATCTCCCTCCT,  downstream forward: _UP4_AACTTGGGAACAAGGGTGAC
BKK02240 ([gene|A39D349BBE13F4F3F6D33DA72CB8149A5170255C|mpr]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK02240 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTGTCATCTCCCTCCT,  downstream forward: _UP4_AACTTGGGAACAAGGGTGAC
References
Reviews
34410368
Original Publications
15375126,24115457,18957862,12107147,25666135,15005613

A39D349BBE13F4F3F6D33DA72CB8149A5170255C

Page visits: 1551

Time of last update: 2022-10-01 19:23:13

Author of last update: Jstuelk