

extracellular metalloprotease

Molecular weight
33.69 kDa
Protein length
Gene length
protein degradation
extracellular metalloprotease

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG3591 (Galperin et al., 2021)

This gene is a member of the following regulons

245,190  246,131
The protein
Protein family
peptidase S1B family (single member, according to UniProt)
[PDB|1P3C] (from B. intermedius, corresponds to aa 95 ... 289, 31% identity) [pubmed|15005613]
extracellular (signal peptide) [Pubmed|18957862]
Expression and Regulation
repressed by casamino acids [Pubmed|12107147]
regulatory mechanism
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, [Pubmed|25666135], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
Open in new tab


2024-02-17 02:33:06





Biological materials
KO7 (''nprE  aprE  epr  mpr  nprB  vpr  bpr''), available as BGSC 1A1133
BKE02240 ([gene|A39D349BBE13F4F3F6D33DA72CB8149A5170255C|mpr]::erm  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTGTCATCTCCCTCCT,  downstream forward: _UP4_AACTTGGGAACAAGGGTGAC
BKK02240 ([gene|A39D349BBE13F4F3F6D33DA72CB8149A5170255C|mpr]::kan  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTGTCATCTCCCTCCT,  downstream forward: _UP4_AACTTGGGAACAAGGGTGAC
Original Publications


Page visits: 2503

Time of last update: 2024-02-25 04:27:17

Author of last update: Jstuelk