kbaA

kbaA
168

activation of the [protein|2111AC1AE49D1006E10DC127BF5B7A0327DE94A7|kinB]-dependent pathway to [wiki|sporulation], control of the [wiki|phosphorelay]

locus
BSU_01560
Molecular weight
22.63 kDa
pI
9.81
Protein length
Gene length
function
control of [wiki|sporulation ]initiation
product
effector of [protein|search|KinB ]activity
essential
no
synonyms
kbaA, ybxC, ybaM

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5810

This gene is a member of the following regulons

Gene
Coordinates
159,182  159,778
The protein
Structure
[AF|P16449]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
additional information
the mRNA is very stable (> 15 min) [pubmed|12884008]
Biological materials
Mutant
BKE01560 ([gene|A3D19A75C5B9A744E6AED40931B5E71157AD48BC|kbaA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE01560 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTCTTTATTCATCCCCT,  downstream forward: _UP4_CTGCCGAAGTTTGCAGCAAA
BKK01560 ([gene|A3D19A75C5B9A744E6AED40931B5E71157AD48BC|kbaA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK01560 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTCTTTATTCATCCCCT,  downstream forward: _UP4_CTGCCGAAGTTTGCAGCAAA
References
12884008,8576055,23199363,29314743

A3D19A75C5B9A744E6AED40931B5E71157AD48BC

Page visits: 2010

Time of last update: 2022-12-01 09:28:51

Author of last update: Jstuelk