SubtiWiki SubtiWiki
yrrN

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

yrrN
168

tRNA uridine hydroxylase (in complex with [protein|D4046AA4C4ACB6A0A2F2020CA1E659F65CAFE68D|yrrO])

locus
BSU_27350
Molecular weight
34.92 kDa
pI
4.64
Protein length
Gene length
function
introduction of 5-methoxyuridine modification in tRNA (U34)
product
tRNA uridine hydroxylase
essential
no
ec
null
synonyms
yrrN, trhP1

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0826

This gene is a member of the following regulons

Gene
Coordinates
2,794,147  2,795,076
Phenotypes of a mutant
50% reduction in mo5U tRNA levels [pubmed|31358606]
The protein
Catalyzed reaction/ biological activity
hydroxylation of U34 in tRNA to give 5-hydroxyuridine (ho5U) (in complex with [protein|D4046AA4C4ACB6A0A2F2020CA1E659F65CAFE68D|yrrO]) with prephenate as hydroxyl donor, ho5U is the precursor for 5-methoxyuridine modification (by [protein|CE4F2965077F2A5882432D683520E09B70B9369A|trmR])  [pubmed|31358606]
Protein family
peptidase U32 family (with [protein|D4046AA4C4ACB6A0A2F2020CA1E659F65CAFE68D|yrrO], according to UniProt)
Paralogous protein(s)
[protein|D4046AA4C4ACB6A0A2F2020CA1E659F65CAFE68D|yrrO]
Expression and Regulation
Operons
genes
[gene|CE4F2965077F2A5882432D683520E09B70B9369A|trmR]-[gene|A3EC327DA14F188E88AF4221B51EE5950F882277|yrrN]-[gene|D4046AA4C4ACB6A0A2F2020CA1E659F65CAFE68D|yrrO]-[gene|A659D9894E777D8A99707CB750DF2918AEE06CE9|udk]-[gene|6FBF27C12B4B3DC2CE373E5199357042114471F8|greA]
description
[Pubmed|22383849]
Open in new tab

[gene|CE4F2965077F2A5882432D683520E09B70B9369A|trmR]→[gene|6FBF27C12B4B3DC2CE373E5199357042114471F8|greA]

2022-01-06 10:19:33

Jstuelk

18

0a66c040f2f5a1d47c0559c4047af2666d30c835

5807E821D8403F7EC565573C8910C732811F8BB4

Biological materials
Mutant
MGNA-A008 (yrrN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/8 NBRP B. subtilis, Japan]
BKE27350 ([gene|A3EC327DA14F188E88AF4221B51EE5950F882277|yrrN]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27350 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGACGTTCACCTCTTCTT,  downstream forward: _UP4_TATTAATCAAAAGGAGGTTA
BKK27350 ([gene|A3EC327DA14F188E88AF4221B51EE5950F882277|yrrN]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27350 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGACGTTCACCTCTTCTT,  downstream forward: _UP4_TATTAATCAAAAGGAGGTTA
References
Research papers
31358606

A3EC327DA14F188E88AF4221B51EE5950F882277

Page visits: 896

Time of last update: 2021-12-21 07:55:09

Author of last update: Jstuelk