yfiQ

At Gram+ 2022 in Prague, there will be a workshop on how to get the most out of SubtiWiki. We will present newly added features. Moreover, we hope to learn from you what you would like to have added to SubtiWiki to improve it!

yfiQ
168

putative membrane-bound acyltransferase

locus
BSU_08360
Molecular weight
40.88 kDa
pI
9.23
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yfiQ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG3936

This gene is a member of the following regulons

Gene
Coordinates
910,840  911,928
The protein
Protein family
Acyltransferase 3 family (with [protein|E97C7A219DB059BB634E893CC355A28324C87ADB|oatA] and [protein|07A53089107037359C428549FF877638B90CF074|ykrP], according to UniProt)
Structure
[AF|O31559]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|A408883503931320B1BC04F38E6D475530518A25|yfiQ]
description
[pubmed|22383849]
Open in new tab

[gene|A408883503931320B1BC04F38E6D475530518A25|yfiQ]

2022-04-12 19:24:46

Jstuelk

6

62dee67cdf83250234552b17577537c68da39ff4

0B17019108209C1A8A45637101FCE2E3FF6301F8

Biological materials
Mutant
MGNA-C305 (yfiQ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2303 NBRP B. subtilis, Japan]
BKE08360 ([gene|A408883503931320B1BC04F38E6D475530518A25|yfiQ]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08360 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAACAGCGCTCCTTTTAT,  downstream forward: _UP4_TGAAAAACAAGCGGCAGGAG
BKK08360 ([gene|A408883503931320B1BC04F38E6D475530518A25|yfiQ]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08360 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAACAGCGCTCCTTTTAT,  downstream forward: _UP4_TGAAAAACAAGCGGCAGGAG

A408883503931320B1BC04F38E6D475530518A25

Page visits: 742

Time of last update: 2022-05-17 08:13:33

Author of last update: Jstuelk