yfiQ

yfiQ
168

putative membrane-bound acyltransferase

locus
BSU_08360
Molecular weight
40.88 kDa
pI
9.23
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yfiQ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG3936

This gene is a member of the following regulons

Gene
Coordinates
910,840  911,928
The protein
Protein family
Acyltransferase 3 family (with [protein|E97C7A219DB059BB634E893CC355A28324C87ADB|oatA] and [protein|07A53089107037359C428549FF877638B90CF074|ykrP], according to UniProt)
Structure
[AF|O31559]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|A408883503931320B1BC04F38E6D475530518A25|yfiQ]
description
[pubmed|22383849]
Open in new tab

[gene|A408883503931320B1BC04F38E6D475530518A25|yfiQ]

2022-04-12 19:24:46

Jstuelk

6

62dee67cdf83250234552b17577537c68da39ff4

0B17019108209C1A8A45637101FCE2E3FF6301F8

Biological materials
Mutant
MGNA-C305 (yfiQ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2303 NBRP B. subtilis, Japan]
BKE08360 ([gene|A408883503931320B1BC04F38E6D475530518A25|yfiQ]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08360 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAACAGCGCTCCTTTTAT,  downstream forward: _UP4_TGAAAAACAAGCGGCAGGAG
BKK08360 ([gene|A408883503931320B1BC04F38E6D475530518A25|yfiQ]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08360 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAACAGCGCTCCTTTTAT,  downstream forward: _UP4_TGAAAAACAAGCGGCAGGAG

A408883503931320B1BC04F38E6D475530518A25

Page visits: 755

Time of last update: 2022-06-27 13:17:08

Author of last update: Jstuelk