recA

recA
168

multifunctional protein involved in homologous recombination and DNA repair ([protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|lexA]-autocleavage), required to internalize and to recombine ssDNA with homologous resident duplex, required for efficient survival and replication restart after replication-transcription conflicts, crucial for the acquisition of homologous genes from related species by natural transformation

locus
BSU_16940
Molecular weight
37.93 kDa
pI
4.88
Protein length
Gene length
function
DNA repair/ recombination
product
multifunctional protein involved in homologous recombination and DNA repair ([protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|lexA]-autocleavage)
essential
no
synonyms
recA, recE

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0468

This gene is a member of the following regulons

Gene
Coordinates
1,764,645 1,765,691
Phenotypes of a mutant
slower growth [Pubmed|26930481]
drastically reduced survival of mature dormant spores after exposure to ultrahigh vacuum desiccation and ionizing radiation that induce single strand (ss) DNA nicks and double-strand breaks (DSBs) [Pubmed|24285298]
reduced [wiki|sporulation] efficiency [Pubmed|26930481]
strongly reduced chromosomal transformation rate [Pubmed|23779106,22373918]
strongly reduced survival after mitomycin treatment [pubmed|34339298]
no amplification of the [gene|44DF1B7E476AD58B3CCC39300FFE0132D0D32AD0|gltA]-[gene|AA07CC52B2DD48ACC9D3375E9D531CB1ACBE485A|gltB] chromosomal region to suppress the glutamate auxotrophy of a [gene|87BCAE725B02860156D50E1783F6DB68510C811E|gltC] mutant [pubmed|28294562]
sensitive to Cr(VI) treatment [pubmed|30745368]
reduced resistance towards electron beams [pubmed|31948638]
reduced viability of a [gene|48BCA38E609E443406E03A32D2BB8DA2E9915A71|rarA] [gene|A44D4677FB70BE8F554BF1001A500F817C7DA95F|recA] double mutant [pubmed|32117122]
suppression of lethality of [gene|C73E52D214E24F21696973B19B0A44CE785D6FBA|pcrA] inactivation [pubmed|32793628]
a [gene|A44D4677FB70BE8F554BF1001A500F817C7DA95F|recA] [gene|B8B0F6B129475FDEEA8D538A51C153BF9A35887D|rnhC] double mutant is not viable [pubmed|33920686]
ATP --> ADP + Pi [pubmed|36321831]
The protein
Catalyzed reaction/ biological activity
RecA stimulates ssDNA phosphorylase activity of [protein|64C6D783FF3F41C81B216F798A1DC8071345B1ED|pnpA] [Pubmed|21859751]
RecA-ATP in concert with [protein|FC53216F600994C862F0C0D017C3FA28EB75DCB6|dprA] and [protein|8DE39680CA7663803A107066FBE9AFFCC77DB72A|ssbA] catalyzes DNA strand exchange, with [protein|1CDF658441061EA476E27C2E60DEE45C4F45AC15|ssbB] as an accessory factor [Pubmed|25138221]
RecA-dATP catalyzes strand exchange even in the absence of the accessory factors [Pubmed|25138221]
protects sporulating cells from DNA damage [Pubmed|26930481]
contributes to transfection with naked phage DNA [pubmed|31876108]
[protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|recA] polymerized on tailed SPP1 duplex intermediates invades a homologous region in another incomplete molecule, and in concert with [protein|A3D05FE662CCCFE79B3CB38486206413B84E5D80|recD2] helicase, reconstitutes a complete linear phage genome with redundant regions at the ends of the molecule [pubmed|31876108]
Protein family
RecA family (together with [protein|151F226370D225776F3FE7EA4901485095F1AC45|radA]) (according to UniProt)
Structure
[PDB|1UBC] (RecA from ''Mycobacterium smegmatis'', 67% identity) [pubmed|12837805]
[AF|P16971]
Modification
phosphorylated on Arg-58 [Pubmed|22517742]
phosphorylated on Ser-2 [Pubmed|20509597] by [protein|E86A96B832351FF513DD9853EAD8998CC44C9951|yabT] [Pubmed|23634894]
Effectors of protein activity
[protein|80E6F156764FF30300D034EE6FB44F2DB8338AF3|recO] and [protein|FC53216F600994C862F0C0D017C3FA28EB75DCB6|dprA] provide [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|recA] access to ssDNA during chromosomal transformation [Pubmed|22373918]
interaction with [protein|2B091CCEE9E34D659771E39B1FC9050A145048AB|disA] inhibits [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|recA] filament growth and [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|recA]-mediated DNA strand exchange [pubmed|30916351]
[wiki|Localization]
colocalizes to the [wiki|replisome] in response to endogenous and exogenous DNA damage and in response to damage-independent fork arrest (formation of DNA repair centers), repair center formation depends on [protein|80E6F156764FF30300D034EE6FB44F2DB8338AF3|recO] and [protein|BEBAF1EB53EBB3E7558BB5FE73C418B50000FA29|recR], and is facilitated by [protein|EBE03AEC7EC594A3115A7A72194BDFF300AA0BFA|recF] and [protein|8DE39680CA7663803A107066FBE9AFFCC77DB72A|ssbA] [Pubmed|24891441]
Nucleoid (Mid-cell) [Pubmed|16479537]
localizes to one cell pole [Pubmed|21278288]
co-localizes with the DNA uptake machinery [Pubmed|17630974]
forms a transient, mobile focus associated with the chromosome during spore development [Pubmed|23634894]
Additional information
belongs to the 100 most abundant proteins [PubMed|15378759]
Expression and Regulation
Operons
genes
[gene|A44D4677FB70BE8F554BF1001A500F817C7DA95F|recA]
description
[Pubmed|7690748]
regulation
induced by conditions that trigger development of genetic competence ([protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|comK]) [Pubmed|7690748]
expression is induced in the presence of Cr(VI) [pubmed|30745368]
regulatory mechanism
[protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|lexA]: repression, [Pubmed|8226626,11555642,16267290], in [regulon|protein:D267AF38B0CF107042326E9B8F3DD3C9C85840E4|lexA regulon]
[protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|comK]: activation, [Pubmed|7690748], in [regulon|protein:08CFA2C72931A75532D4289BC1D18A826DE9F9CA|comK regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|7690748], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|A44D4677FB70BE8F554BF1001A500F817C7DA95F|recA]

2022-12-02 16:14:27

Jstuelk

53

b5f3c0792ce95f73c71b97dead2eec740cbe7f8a

0F9DC80A650EA38C0E73D576717066E201884262

Biological materials
Mutant
IRN444 (cat), available in [wiki|Jörg Stülke]'s lab
GP2542([gene|A44D4677FB70BE8F554BF1001A500F817C7DA95F|recA]::spc trpC2), available in [wiki|Jörg Stülke]'s lab
1A746 (''recA''::''erm''), [Pubmed|1391055], available at the [http://bgsc.org/getdetail.php?bgscid=1A746 Bacillus Genetic Stock Center]
1A786 (''recA''::''kan''), [Pubmed|11208805], available at the [http://bgsc.org/getdetail.php?bgscid=1A786 Bacillus Genetic Stock Center]
BP469 (''recA''::''erm''), available in [wiki|Fabian Commichau]'s lab
BKE16940 (''[gene|A44D4677FB70BE8F554BF1001A500F817C7DA95F|recA]''::''erm'', available in the [http://bgsc.org/ Bacillus Genetic Stock Center], in [wiki|Fabian Commichau]'s, and in [wiki|Jörg Stülke]'s labs) [pubmed|28189581]
BKE16940 ([gene|A44D4677FB70BE8F554BF1001A500F817C7DA95F|recA]::erm [gene|search|trpC2]) available at [http://bgsc.org/getdetail.php?bgscid=BKE16940 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTATTTTTTCCTCCTT, downstream forward: _UP4_TAAAAATAAAATAAGTTTCA
BKK16940 ([gene|A44D4677FB70BE8F554BF1001A500F817C7DA95F|recA]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK16940 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTATTTTTTCCTCCTT, downstream forward: _UP4_TAAAAATAAAATAAGTTTCA
Expression vectors
for expression, purification in ''E. coli'' with N-terminal His-tag, pRSETA available in [wiki|Ulf Gerth]'s lab
two-hybrid system
B. pertussis adenylate cyclase-based bacterial two hybrid system ([wiki|BACTH]), available in [wiki|Fabian Commichau]'s lab
labs
[wiki|Peter Graumann], Freiburg University, Germany [http://www.biologie.uni-freiburg.de/data/bio2/graumann/index.htm homepage]
References
Reviews
14527291,12045091,10506835,14616075,21517913,23046409,23380520,22933559,17364684,26459995,31950915,32286623,33510358
Original Publications
11814663,16061691,19060143,17803906,16024744,17630974,8226626,11555642,16479537,19730681,7690748,17229847,16267290,20509597,20723756,17449621,21278288,22373918,22517742,23284295,23536821,21859751,23634894,23779106,24285298,24285298,24373815,15378759,24362571,8899710,24670664,24891441,25138221,25169108,25939832,26001966,26786319,26930481,28294562,28344191,28911099,30050509,30254116,30401797,30745368,30814990,30877841,12837805,30975899,30916351,31350886,31876108,31948638,32117122,32793628,33264457,33476368,33920686,34339298,34880841,35223992,35234892,36321831

A44D4677FB70BE8F554BF1001A500F817C7DA95F

Page visits: 9961

Time of last update: 2022-12-06 02:17:39

Author of last update: Jstuelk