yabG

yabG
168

sporulation-specific cysteine protease

locus
BSU_00430
Molecular weight
33.17 kDa
pI
9.14
Protein length
Gene length
function
modification of spore coat proteins
product
cysteine protease
essential
no
synonyms
yabG

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5866

This gene is a member of the following regulons

Gene
Coordinates
51,680  52,552
The protein
Catalyzed reaction/ biological activity
temperature-dependent modification of the coat proteins such as [protein|1CA990DA55B6F879968C431A703E0478F5564A1A|gerQ] (together with [protein|4A2B1DA38608E5A4096087BF7246D4C64C54DBE3|tgl]) [Pubmed|16751597]
cleaves the spore coat proteins [protein|A25C1530DA7BB007A288E525404E9F775E219FE8|spoIVA] and [protein|CEBEC9CECCF445C40D793E61A2CD23175631A473|safA] [pubmed|11040425]
Protein family
Peptidase U57 family (together with [protein|8EDB1BCEEE64FDAF1C9054300751FCB420658865|yabR]) (according to UniProt)
Structure
[AF|P37548]
[wiki|Localization]
forespore outer membrane (according to Swiss-Prot),  spore coat [Pubmed|19060142]
Additional information
colocalizes in the spore coat with [protein|D2A0A4793350632217F4425EB6F459B538067CD7|yeeK] [Pubmed|19060142]
active site: Cys-218 and His-172 [pubmed|34865059]
Expression and Regulation
Operons
genes
[gene|A46D07F8F56249A04C5F880120D19F00C9CAE112|yabG]
description
[Pubmed|10714992]
regulation
expressed late during sporulation in the mother cell ([protein|search|SigK]) [Pubmed|15699190,10714992]
sigma factors
[protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK]: sigma factor, [Pubmed|15699190,10714992], in [regulon|protein:24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK regulon]
Open in new tab

[gene|A46D07F8F56249A04C5F880120D19F00C9CAE112|yabG]

2022-11-26 05:13:50

ghost

28

2804508974f6854415e24d8930e5be87f9f247d0

7517E33B5D7865642F24D89A17248D0C78C76ED7

Biological materials
Mutant
MGNA-B908 (yabG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1907 NBRP B. subtilis, Japan]
1S128 ( ''yabG''::''erm''), [Pubmed|16751597], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1S128&Search=1S128 BGSC]
1S128 ( ''yabG''::''erm''), [Pubmed|16751597], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1S128&Search=1S128 BGSC]
1A814 ( ''yabG''::''spec''), [Pubmed|11267663], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A814&Search=1A814 BGSC]
BKE00430 ([gene|A46D07F8F56249A04C5F880120D19F00C9CAE112|yabG]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE00430 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACGTTCCTCACTCCACACA,  downstream forward: _UP4_TAACAGTTGAAAACCTGCAT
BKK00430 ([gene|A46D07F8F56249A04C5F880120D19F00C9CAE112|yabG]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK00430 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACGTTCCTCACTCCACACA,  downstream forward: _UP4_TAACAGTTGAAAACCTGCAT
References
Reviews
19797877
Original Publications
10714992,19060142,16751597,15699190,11040425,34865059

A46D07F8F56249A04C5F880120D19F00C9CAE112

Page visits: 2217

Time of last update: 2022-11-26 19:21:09

Author of last update: Jstuelk