albE

albE
168

antilisterial bacteriocin (subtilosin) production

locus
BSU_37410
Molecular weight
43.20 kDa
pI
6.07
Protein length
Gene length
function
antilisterial bacteriocin (subtilosin) production
product
processing protease
essential
no
ec
null
synonyms
albE, ywhO

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0612

This gene is a member of the following regulons

Gene
Coordinates
3,839,852  3,841,012
The protein
Structure
[PDB|7Y8U] ([protein|A474F01AA4AD859963E39CD528BC42FF43A72433|albE]-[protein|D03FB4EAEFBC25A5B0459CF464BFADF1FC7620B2|albF] complex from Quasibacillus thermotolerans) [pubmed|36302388]
[AF|P71007]
Expression and Regulation
Operons
genes
[gene|8CBBEC47A5CC3EAE73BE68E68417C5F2A4DA5C23|sboA]-[gene|83AAFAA187B4FCEE24B4EA2DD4935425A3B48DAA|sboX]-[gene|DEDA6F03386F360F6C0B2CC5F09DF3C9D85173F1|albA]-[gene|D399B25AE22ECB6C7ACDCFF4DCE4D9D908184E75|albB]-[gene|19CC58F5ABADAD45BA55D88BBD77B586AA5D85FE|albC]-[gene|DAD8308DF72E648610D1A12BC92063E1550CB1B4|albD]-[gene|A474F01AA4AD859963E39CD528BC42FF43A72433|albE]-[gene|D03FB4EAEFBC25A5B0459CF464BFADF1FC7620B2|albF]-[gene|55A34610EF7AA5E515DE3DCDA333ED3A42B0EF08|albG]
description
[Pubmed|10572140]
regulation
expressed under anaerobic conditions ([protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|resD]) [Pubmed|10809710]
expression
expression is heterogeneous [pubmed|35171018]
regulatory mechanism
[protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|rok]: repression, [Pubmed|15743949], in [regulon|protein:1508770D5BCA5739D13E3ABD11CC5C103C07FF25|rok regulon]
[protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|resD]: activation, [Pubmed|10809710], in [regulon|protein:1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|resD regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [PubMed|10572140,17720793], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|10572140], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|8CBBEC47A5CC3EAE73BE68E68417C5F2A4DA5C23|sboA]→[gene|55A34610EF7AA5E515DE3DCDA333ED3A42B0EF08|albG]

2022-11-25 02:57:05

Jstuelk

45

ED4C73B393EFE70C9997D5F8774AA65E87AA8132

4E5A98D6615C53214EC58E0D67F433A287A88522

Biological materials
Mutant
MGNA-A527 (ywhO::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/527 NBRP B. subtilis, Japan]
BKE37410 ([gene|A474F01AA4AD859963E39CD528BC42FF43A72433|albE]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE37410 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TGAAAATTGATGAGTCTTCA,  downstream forward: _UP4_GCTCATGTAGTAAGGGGATG
BKK37410 ([gene|A474F01AA4AD859963E39CD528BC42FF43A72433|albE]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK37410 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TGAAAATTGATGAGTCTTCA,  downstream forward: _UP4_GCTCATGTAGTAAGGGGATG
References
10809709,10572140,15743949,10809710,10572140,17720793,36302388

A474F01AA4AD859963E39CD528BC42FF43A72433

Page visits: 2755

Time of last update: 2022-12-01 09:41:25

Author of last update: Jstuelk