SubtiWiki SubtiWiki
albE
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

albE
168

antilisterial bacteriocin (subtilosin) production

locus
BSU_37410
Molecular weight
43.20 kDa
pI
6.07
Protein length
Gene length
function
antilisterial bacteriocin (subtilosin) production
product
processing protease
essential
no
ec
null
synonyms
albE, ywhO

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0612

This gene is a member of the following regulons

Gene
Coordinates
3,839,852  3,841,012
Expression and Regulation
Operons
genes
[gene|8CBBEC47A5CC3EAE73BE68E68417C5F2A4DA5C23|sboA]-[gene|83AAFAA187B4FCEE24B4EA2DD4935425A3B48DAA|sboX]-[gene|DEDA6F03386F360F6C0B2CC5F09DF3C9D85173F1|albA]-[gene|D399B25AE22ECB6C7ACDCFF4DCE4D9D908184E75|albB]-[gene|19CC58F5ABADAD45BA55D88BBD77B586AA5D85FE|albC]-[gene|DAD8308DF72E648610D1A12BC92063E1550CB1B4|albD]-[gene|A474F01AA4AD859963E39CD528BC42FF43A72433|albE]-[gene|D03FB4EAEFBC25A5B0459CF464BFADF1FC7620B2|albF]-[gene|55A34610EF7AA5E515DE3DCDA333ED3A42B0EF08|albG]
description
[Pubmed|10572140]
regulation
expressed under anaerobic conditions ([protein|search|ResD]) [Pubmed|10809710]
regulatory mechanism
[protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|rok]: repression, [Pubmed|15743949], in [regulon|protein:1508770D5BCA5739D13E3ABD11CC5C103C07FF25|rok regulon]
[protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|resD]: activation, [Pubmed|10809710], in [regulon|protein:1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|resD regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [PubMed|10572140,17720793], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|10572140], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|8CBBEC47A5CC3EAE73BE68E68417C5F2A4DA5C23|sboA]→[gene|55A34610EF7AA5E515DE3DCDA333ED3A42B0EF08|albG]

2021-09-18 05:52:32

ghost

9

ed4c73b393efe70c9997d5f8774aa65e87aa8132

4E5A98D6615C53214EC58E0D67F433A287A88522

Biological materials
Mutant
MGNA-A527 (ywhO::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/527 NBRP B. subtilis, Japan]
BKE37410 ([gene|A474F01AA4AD859963E39CD528BC42FF43A72433|albE]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37410 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TGAAAATTGATGAGTCTTCA,  downstream forward: _UP4_GCTCATGTAGTAAGGGGATG
BKK37410 ([gene|A474F01AA4AD859963E39CD528BC42FF43A72433|albE]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37410 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TGAAAATTGATGAGTCTTCA,  downstream forward: _UP4_GCTCATGTAGTAAGGGGATG
References
10809709,10572140,15743949,10809710,10572140,17720793

A474F01AA4AD859963E39CD528BC42FF43A72433

Page visits: 2178

Time of last update: 2021-09-21 10:51:05

Author of last update: Bzhu