ybaJ

ybaJ
168

unknown

locus
BSU_01510
Molecular weight
28.20 kDa
pI
4.94
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
ybaJ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2227

This gene is a member of the following regulons

Gene
Coordinates
155,156  155,923
The protein
Protein family
[wiki|Methyltransferase superfamily] (according to UniProt)
Structure
[AF|P70976]
Expression and Regulation
Operons
genes
[gene|A482C4C416093F544945340296AC803E08090414|ybaJ]
description
[pubmed|22383849]
regulatory mechanism
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
Open in new tab

[gene|A482C4C416093F544945340296AC803E08090414|ybaJ]

2022-11-26 22:34:34

Bzhu

16

ae398f819b79931e5b96c164149359a91c41ae0d

D140F4702F4B9800A9DA19CA7A33C806F1F41221

Biological materials
Mutant
MGNA-B946 (ybaJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1945 NBRP B. subtilis, Japan]
BKE01510 ([gene|A482C4C416093F544945340296AC803E08090414|ybaJ]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE01510 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGAATCTTCTCCTTACTT,  downstream forward: _UP4_TGAAAAGCAGCGACCTGTTA
BKK01510 ([gene|A482C4C416093F544945340296AC803E08090414|ybaJ]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK01510 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGAATCTTCTCCTTACTT,  downstream forward: _UP4_TGAAAAGCAGCGACCTGTTA
References
20817675

A482C4C416093F544945340296AC803E08090414

Page visits: 1096

Time of last update: 2022-12-01 12:14:21

Author of last update: Jstuelk