Register now for Subtillery 2022, the International Online Meeting on Bacillus subtilis! It will be held from the 19th-22th of September.


involved in polyketide synthesis

Molecular weight
29.26 kDa
Protein length
Gene length
polyketide synthesis

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1024

This gene is a member of the following regulons

1,791,193  1,791,972
The protein
Protein family
[wiki|enoyl-CoA hydratase/isomerase family] (according to UniProt)
Expression and Regulation
expressed during the transition from growth to stationary phase ([protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB], [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]) [Pubmed|24187085]
heterogeneous expression, percentage of expressing cells increases during colonization of plant roots [pubmed|34557426]
regulatory mechanism
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|24187085], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: activation, [Pubmed|24187085], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
additional information
this is a very large operon comprising about 75 kb
Open in new tab


2022-07-22 00:02:56





Open in new tab


2022-07-22 00:06:58





Biological materials
BKE17160 ([gene|A4CF68F602273CFDFD55EFD2C1164F0E2E8F6972|pksH]::erm  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GCGGACCTTTATCGTTTGAT,  downstream forward: _UP4_TAACCGTTTAAAAATGACAA
BKK17160 ([gene|A4CF68F602273CFDFD55EFD2C1164F0E2E8F6972|pksH]::kan  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GCGGACCTTTATCGTTTGAT,  downstream forward: _UP4_TAACCGTTTAAAAATGACAA


Page visits: 1551

Time of last update: 2022-08-07 11:05:59

Author of last update: Melvin.boenninger