lplA

lplA
168

lipoprotein, putative [wiki|ABC transporter] (solute binding protein)

locus
BSU_07100
Molecular weight
56.05 kDa
pI
5.61
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
lplA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1653

This gene is a member of the following regulons

Gene
Coordinates
779,529  781,037
The protein
Structure
[PDB|3VLU] (from Sphingomonas sp., corresponds to aa 80 ... 379, 26% identity) [pubmed|22486720]
[AF|P37966]
Paralogous protein(s)
[protein|2D46E89AF6157B49BD443F47DB4A7258F22E8A24|ytcQ]
[wiki|Localization]
associated to the membrane (via [protein|AA19541BCCAE08B48BD23F4E8337EBA220E5C4EF|lplB]-[protein|0A7FF3E2747598AE0EE39183E8827879C4B11A80|lplC]) [Pubmed|10092453]
Biological materials
Mutant
BKE07100 ([gene|A4DA5C00BA37FF65E4190EC95B183ABAF1C9364D|lplA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE07100 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTGCGTAAGTCCCCCT,  downstream forward: _UP4_TAAACCGATGCGCCTGCCTT
BKK07100 ([gene|A4DA5C00BA37FF65E4190EC95B183ABAF1C9364D|lplA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK07100 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTGCGTAAGTCCCCCT,  downstream forward: _UP4_TAAACCGATGCGCCTGCCTT
References
7921237,10092453,22486720

A4DA5C00BA37FF65E4190EC95B183ABAF1C9364D

Page visits: 1026

Time of last update: 2022-11-27 06:05:37

Author of last update: Jstuelk