ntdB

ntdB
168

kanosamine-6-phosphate phosphatase

locus
BSU_10540
Molecular weight
33.05 kDa
pI
5.35
Protein length
Gene length
function
synthesis of the antibiotic kanosamine
product
kanosamine-6-phosphate phosphatase
essential
no
synonyms
ntdB, yhjK

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0561

This gene is a member of the following regulons

Gene
Coordinates
1,127,466  1,128,314
The protein
Catalyzed reaction/ biological activity
kanosamine-6-phosphate --> kanosamine [Pubmed|23586652]
Protein family
[wiki|HAD superfamily] (according to UniProt)
[wiki|Cof family] (according to UniProt)
Structure
[PDB|3GYG]
[AF|O07565]
Expression and Regulation
Operons
genes
[gene|2F850E2DFA6287DB3890243803E06FDE7ACDB10E|ntdA]-[gene|A4DE6C394B64813A732255734758403241FFAC2F|ntdB]-[gene|29DAF5343A42EAD8DB97925FE7D049410F7B7FCA|ntdC]-[gene|ADB476B0B385D9B9CAF02902CE115C8309F67911|glcP]
description
[Pubmed|17056753]
regulation
induced by 3,3'-neotrehalosadiamine and kanosamine ([protein|9118A36CD30E7C99697B3659BB04E03BB7EE71D7|ntdR]) [Pubmed|33619155,14612444]
regulatory mechanism
[protein|9118A36CD30E7C99697B3659BB04E03BB7EE71D7|ntdR]: activation , in [regulon|protein:9118A36CD30E7C99697B3659BB04E03BB7EE71D7|ntdR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|14612444], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|2F850E2DFA6287DB3890243803E06FDE7ACDB10E|ntdA]→[gene|ADB476B0B385D9B9CAF02902CE115C8309F67911|glcP]

2022-11-17 11:14:06

Jstuelk

26

41B772604ED3B8BA7F5F0AFF19B989A8E4F9FDC1

2A657E0F29C43EAF1C8F99F810D2B0756ABA88B3

Biological materials
Mutant
MGNA-A724 (yhjK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/724 NBRP B. subtilis, Japan]
BKE10540 ([gene|A4DE6C394B64813A732255734758403241FFAC2F|ntdB]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE10540 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AGGATGTTCAACCGTGGATA,  downstream forward: _UP4_ATTGGATCATGAGGAGGAAA
BKK10540 ([gene|A4DE6C394B64813A732255734758403241FFAC2F|ntdB]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK10540 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AGGATGTTCAACCGTGGATA,  downstream forward: _UP4_ATTGGATCATGAGGAGGAAA
References
Reviews
21512256
Original Publications
19087206,17056753,14612444,23586652

A4DE6C394B64813A732255734758403241FFAC2F

Page visits: 1428

Time of last update: 2022-11-29 06:34:43

Author of last update: Melvin.boenninger