araR

araR
168

transcriptional repressor ([wiki|GntR family], [wiki|LacI family]) of the arabinose utilization genes

locus
BSU_33970
Molecular weight
43.00 kDa
pI
6.34
Protein length
Gene length
function
regulation of arabinose utilization
product
transcriptional repressor ([wiki|GntR family], [wiki|LacI family])
essential
no
synonyms
araR, araC, yvbS

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1609

This gene is a member of the following regulons

Gene
Coordinates
3,485,604  3,486,758
Phenotypes of a mutant
inactivation of ''[gene|A567466894AE9DE7CDE7816615433A37532297B5|araR]'' reduces sporulation efficiency to 28% that of wild type cells [Pubmed|26735940]
The protein
Protein family
[wiki|GntR family]: N-terminal DNA-binding domain, [wiki|LacI family]: C-terminal effector-binding domain
[wiki|Domains]
N-terminal DNA-binding domain ([wiki|GntR family])
C-terminal effector-binding domain ([wiki|LacI family])
[wiki|HTH gntR-type domain] (aa 1-70) (according to UniProt)
Structure
[PDB|3TB6] (effector-binding domain) [Pubmed|22281747]
[AF|P96711]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|A567466894AE9DE7CDE7816615433A37532297B5|araR]
description
[Pubmed|9045819]
regulation
induced by arabinose ([protein|search|AraR]) [Pubmed|10417639]
regulatory mechanism
[protein|A567466894AE9DE7CDE7816615433A37532297B5|araR]: repression, [Pubmed|10417639], in [regulon|protein:A567466894AE9DE7CDE7816615433A37532297B5|araR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|9401028], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|A567466894AE9DE7CDE7816615433A37532297B5|araR]

2022-11-30 20:22:11

ghost

18

d2286298f3ef689746c3c4c984f3c45640b8c9d3

5D0C5E53C9A992BBDE4EE32495B12C8CA2AFA294

Biological materials
Mutant
BKE33970 ([gene|A567466894AE9DE7CDE7816615433A37532297B5|araR]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE33970 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATCCATTCCTCCAAAAT,  downstream forward: _UP4_TAAAAAAAGCAATGTATGGG
BKK33970 ([gene|A567466894AE9DE7CDE7816615433A37532297B5|araR]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK33970 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATCCATTCCTCCAAAAT,  downstream forward: _UP4_TAAAAAAAGCAATGTATGGG
References
17617643,3131313,16585763,10417639,11418559,14973026,9045819,23109551,25364981,22281747,26151451,26511320,26735940

A567466894AE9DE7CDE7816615433A37532297B5

Page visits: 3763

Time of last update: 2022-12-02 19:33:11

Author of last update: Melvin.boenninger