bcrC

bcrC
168

undecaprenyl pyrophosphate phosphatase, produces the carrier lipid for cell wall synthesis, secondary bacitracin resistance determinant

locus
BSU_36530
Molecular weight
21.58 kDa
pI
9.45
Protein length
Gene length
function
cell wall synthesis, resistance to bacitracin and oxidative stress
product
undecaprenyl pyrophosphate phosphatase
essential
no
ec
3.6.1.27
synonyms
bcrC, ywoA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0671

This gene is a member of the following regulons

Gene
Coordinates
3,758,547  3,759,128
Phenotypes of a mutant
5-fold increased sensitivity to bacitracin [Pubmed|26815905]
reduced growth rate [Pubmed|26815905]
increased susceptibility to rare earth elements [Pubmed|22904278]
a ''[gene|A58729F80A0BB6683648E472E385711A6DE4D373|bcrC]'' ''[gene|5A7A79A11FCBA9C90DAF526B8EAB6791D7D88E99|uppP]'' double mutant is not viable (unless ''[gene|0BF97861B52722347C4BBE533E574CF548A8283E|pgpB]'' is artificially expressed) [Pubmed|27528508]
The protein
Catalyzed reaction/ biological activity
undecaprenyl pyrophosphate - undecaprenyl phosphate
di-trans,octa-cis-undecaprenyl diphosphate + H2O --> di-trans,octa-cis-undecaprenyl phosphate + H+ + phosphate (according to UniProt)
Protein family
BcrC/YbjG family (single member, according to UniProt)
Structure
[AF|P94571]
Effectors of protein activity
inhibited by heptaprenyl pyrophosphate which accumulates in a ''[gene|596C09DD1D9C305B7C49B2F5E90E2C6C33F63D0E|ytpB]'' mutant [Pubmed|24806199]
[wiki|Localization]
cell membrane (according to Swiss-Prot)
Additional information
there is a second undecaprenyl pyrophosphate phosphatase in ''B. subtilis'', [protein|5A7A79A11FCBA9C90DAF526B8EAB6791D7D88E99|uppP]. However, [protein|5A7A79A11FCBA9C90DAF526B8EAB6791D7D88E99|uppP] seems to play only a minor role. [Pubmed|22904278]
Expression and Regulation
Operons
genes
[gene|A58729F80A0BB6683648E472E385711A6DE4D373|bcrC]
description
[pubmed|12850135]
regulation
expression activated by glucose (3.3 fold) [Pubmed|12850135]
sigma factors
[protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM]: sigma factor, [Pubmed|17434969], in [regulon|protein:081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM regulon]
[protein|3DEAC421B4B173C6BBC700E57790751B7AFDF319|sigI]: sigma factor, [Pubmed|18156261], in [regulon|protein:3DEAC421B4B173C6BBC700E57790751B7AFDF319|sigI regulon]
[protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW]: sigma factor, [Pubmed|11866510], in [regulon|protein:3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW regulon]
[protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|sigX]: sigma factor, [Pubmed|12399481], in [regulon|protein:E77364F274A520FCCA9F5C9504E317B047BA29E6|sigX regulon]
[protein|D04629D798E458AD538809BB2B150B7FA81D2C7E|sigV]: sigma factor, in [regulon|protein:D04629D798E458AD538809BB2B150B7FA81D2C7E|sigV regulon]
Open in new tab

[gene|A58729F80A0BB6683648E472E385711A6DE4D373|bcrC]

2022-06-14 09:20:10

Jstuelk

18

011562D3F9267D7D773C8FBB41620002798450E7

D57FA2D27F5785DF653A6EF5C57F504B07626F62

Biological materials
Mutant
MGNA-A214 (ywoA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/214 NBRP B. subtilis, Japan]
BKE36530 ([gene|A58729F80A0BB6683648E472E385711A6DE4D373|bcrC]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36530 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAATAATCACCTTTTACAT,  downstream forward: _UP4_TAAGAAAGACAAAAGCCGGC
BKK36530 ([gene|A58729F80A0BB6683648E472E385711A6DE4D373|bcrC]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36530 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAATAATCACCTTTTACAT,  downstream forward: _UP4_TAAGAAAGACAAAAGCCGGC
References
Reviews
27344142
Original Publications
17434969,18156261,22904278,14612242,12486040,12399481,17434969,15838020,14651641,24068241,24806199,21926231,15946938,26364265,27528508,27578312,26815905,29259598,29914988,32019833

A58729F80A0BB6683648E472E385711A6DE4D373

Page visits: 3187

Time of last update: 2022-06-25 08:08:58

Author of last update: Jstuelk