ycdG

ycdG
168

general stress protein, similar to oligo-1,6-glucosidase

locus
BSU_02840
Molecular weight
65.64 kDa
pI
5.21
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
3.2.1.10
synonyms
ycdG

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0366

This gene is a member of the following regulons

Gene
Coordinates
306,459  308,144
The protein
Catalyzed reaction/ biological activity
Hydrolysis of (16)-alpha-D-glucosidic linkages in some oligosaccharides produced from starch and glycogen by alpha-amylase, and in isomaltose (according to UniProt)
Protein family
[wiki|glycosyl hydrolase 13 family] (according to UniProt)
Structure
[PDB|1UOK] (from ''Bacillus Cereus'', 54% identity)
[AF|O34364]
Paralogous protein(s)
[protein|A9500B1E45CCE51F4A699E4A7BC1F6B272A25A86|yugT], [protein|2EB9E0C492DF57DF683817E31D6DD34D7580E631|treA], [protein|6E5AB4620F9A896C32CD77AF314C67035814AE0A|malL]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|B6FF689E65906186F3576B378650D713DB84EDDA|ycdF]-[gene|A641BA91317CBCFE34A2BE69007247F209075095|ycdG]
description
[Pubmed|15805528]
regulation
induced by stress ([protein|search|SigB]) [Pubmed|15805528,11544224]
sigma factors
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|15805528,11544224], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
Open in new tab

[gene|B6FF689E65906186F3576B378650D713DB84EDDA|ycdF]→[gene|A641BA91317CBCFE34A2BE69007247F209075095|ycdG]

2022-11-29 22:12:14

ghost

30

22eb8e4a5f3738fe6914742f46af74f81b9c90a9

CC9BB92A08F6FA00BFDF6CC244282F733CBD5AB7

Biological materials
Mutant
BKE02840 ([gene|A641BA91317CBCFE34A2BE69007247F209075095|ycdG]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE02840 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCCCGCAATCCCCCTGTT,  downstream forward: _UP4_TAATGATTGAAGTAGCCCGG
BKK02840 ([gene|A641BA91317CBCFE34A2BE69007247F209075095|ycdG]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK02840 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCCCGCAATCCCCCTGTT,  downstream forward: _UP4_TAATGATTGAAGTAGCCCGG
References
11544224

A641BA91317CBCFE34A2BE69007247F209075095

Page visits: 1465

Time of last update: 2022-12-05 01:43:09

Author of last update: Melvin.boenninger