kinC

kinC
168

two-component sensor kinase, phosphorylates [protein|9896B99346B0D3F6D57F57377DB253B46135A37A|spo0F] and [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A], part of the [wiki|phosphorelay], governs expression of genes involved in [wiki|biofilm formation]

locus
BSU_14490
Molecular weight
48.68 kDa
pI
6.22
Protein length
Gene length
function
initiation of [wiki|sporulation]
product
two-component sensor kinase
essential
no
synonyms
kinC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5807

This gene is a member of the following regulons

Gene
Coordinates
1,518,333  1,519,619
Phenotypes of a mutant
defective in [wiki|biofilm formation] [Pubmed|22882210]
The protein
Catalyzed reaction/ biological activity
autophosphorylation, phosphorylation and dephosphorylation of [protein|9896B99346B0D3F6D57F57377DB253B46135A37A|spo0F] as part of the [wiki|phosphorelay] [pubmed|35012345]
direct phosphorylation of [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A] [Pubmed|19114652]
mainly active in the younger, outer regions of a colony (with [protein|511E71BB1981758857854C8E9BF657287CE60C11|kinD]) [Pubmed|21097618]
phosphorylates [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A] in response to the presence of surfactin [Pubmed|22882210], this has been refuted [Pubmed|25701730]
required for initiation of [wiki|sliding] together with [protein|2111AC1AE49D1006E10DC127BF5B7A0327DE94A7|kinB] [Pubmed|26152584]
[wiki|Domains]
two transmembrane segments
[wiki|PAS domain] (aa 76-147) (according to UniProt)
[wiki|PAC domain] (aa 148-22) (according to UniProt)
[wiki|Histidine kinase domain] (aa 221-426) (according to UniProt)
Structure
[PDB|3A0R] (HK-RR complex from Thermotoga maritima, 28% identity) [pubmed|19836334]
[AF|P39764]
Modification
autophosphorylation on a His residue
Effectors of protein activity
activity is triggered by potassium leakage [Pubmed|19114652], this has been refuted [Pubmed|25701730]
activity is triggered by polyisoprenoid lipids formed by [protein|E5F32D960F6FF50A7B0E4B268D2296FE1A291512|yisP] [Pubmed|20713508]
activity is stimulated by the interaction with [protein|61893B4EB53FBBB9AD8BEEEFFCEFD0FC64544D6F|floT] [Pubmed|26297017]
[wiki|Localization]
cell membrane (Heterogeneous) [Pubmed|16479537]
co-localizes with [protein|61893B4EB53FBBB9AD8BEEEFFCEFD0FC64544D6F|floT] in discrete foci in the membrane [Pubmed|20713508]
the localization of [protein|A656321846B2E0D1F39B528E2D8B8E620CCD1148|kinC] in membrane microdomains depends on [protein|11A55829B4C3E8EA434A600FF7B4102F8E5A7DCE|floA] and [protein|61893B4EB53FBBB9AD8BEEEFFCEFD0FC64544D6F|floT]  [Pubmed|22882210], this has been refuted [Pubmed|25701730]
Expression and Regulation
Operons
genes
[gene|A656321846B2E0D1F39B528E2D8B8E620CCD1148|kinC]-[gene|22DBF4D1F93519A95E6BCC0FB1AC2387DF444E27|ykqA]-[gene|15F9BF08762D28CBCD3D9748EFBD29B0D6FD7623|ktrC]
description
[Pubmed|22383849]
regulation
constitutively expressed [Pubmed|12562800]
regulatory mechanism
[protein|2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A]: activation, [Pubmed|8002615], in [regulon|protein:2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|8002614], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|A656321846B2E0D1F39B528E2D8B8E620CCD1148|kinC]→[gene|15F9BF08762D28CBCD3D9748EFBD29B0D6FD7623|ktrC]

2022-12-05 07:27:25

ghost

47

13fec2f53403530776626371dde75ae36f8ffdcc

89B46AE807A9C6714638DCFE0DFEACD209BF81BB

Biological materials
Mutant
1A632 ( ''kinC''::''erm''), [Pubmed|3015878], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A632&Search=1A632 BGSC]
BAL393 (''kinC''::''spc'')[Pubmed|26152584]
BKE14490 ([gene|A656321846B2E0D1F39B528E2D8B8E620CCD1148|kinC]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE14490 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATGACCACCTGCCGCTT,  downstream forward: _UP4_GACAGCTGAGAGGAGAAAAA
BKK14490 ([gene|A656321846B2E0D1F39B528E2D8B8E620CCD1148|kinC]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK14490 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATGACCACCTGCCGCTT,  downstream forward: _UP4_GACAGCTGAGAGGAGAAAAA
References
Reviews
25934647,25652542,35195292
Original Publications
26152584,19114652,10094672,11069677,16166384,20713508,8002615,16479537,8002614,20946851,20971918,21097618,22882210,23927765,25701730,26297017,26152584,28461449,19836334,35012345

A656321846B2E0D1F39B528E2D8B8E620CCD1148

Page visits: 4200

Time of last update: 2022-12-05 01:19:22

Author of last update: Jstuelk