yetM

yetM
168

FAD-dependent monooxygenase

locus
BSU_07230
Molecular weight
40.82 kDa
pI
5.34
Protein length
Gene length
function
unknown
product
FAD-dependent monooxygenase
essential
no
synonyms
yetM

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0654

This gene is a member of the following regulons

Gene
Coordinates
790,318  791,427
The protein
[wiki|Cofactors]
FAD (according to UniProt) [Pubmed|21635694]
Structure
[PDB|4H2N] (from Mesorhizobium japonicum, 30% identity)
[AF|O06489]
Expression and Regulation
Operons
genes
[gene|A70EA4AEBF46ED2279E8BCE8A28439078484B6E3|yetM]
description
[Pubmed|19329649]
regulation
induced by flavonoids of kaempferol, apigenin, and luteolin ([protein|search|YetL])[Pubmed|19329649]
regulatory mechanism
[protein|BFAFC2CFA7F2FDA639B367C579E2A46242BA3DBD|yetL]: repression, [Pubmed|19329649], in [regulon|protein:BFAFC2CFA7F2FDA639B367C579E2A46242BA3DBD|yetL regulon]
Open in new tab

[gene|A70EA4AEBF46ED2279E8BCE8A28439078484B6E3|yetM]

2022-11-29 12:34:50

ghost

15

5640ea7e1110afa4abc594ea1ecf492dbcbd4896

D4B575EFB104A4013A70B57E1145986C255EFCD8

Biological materials
Mutant
MGNA-B464 (yetM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1463 NBRP B. subtilis, Japan]
BKE07230 ([gene|A70EA4AEBF46ED2279E8BCE8A28439078484B6E3|yetM]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE07230 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATCAATAACCACCTTTT,  downstream forward: _UP4_TAAATAGGAAAAGTCCAGAA
BKK07230 ([gene|A70EA4AEBF46ED2279E8BCE8A28439078484B6E3|yetM]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK07230 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATCAATAACCACCTTTT,  downstream forward: _UP4_TAAATAGGAAAAGTCCAGAA
References
19329649,19329649

A70EA4AEBF46ED2279E8BCE8A28439078484B6E3

Page visits: 1217

Time of last update: 2022-11-29 07:45:29

Author of last update: Jstuelk