ylzJ

ylzJ
168

germination protein, required for TepA activity

locus
BSU_16799
Molecular weight
8.00 kDa
pI
4.905
Protein length
Gene length
function
control of TepA activity
product
germination protein
essential
-
ec
null
synonyms
ylzJ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
1,751,935  1,752,147
The protein
Catalyzed reaction/ biological activity
the protein is required to allow [protein|A16C6515D185E3A268D57D77F28EF7EF9AF9FE05|tepA] proteolytic activity otwards SASPs [Pubmed|23927687]
Structure
[AF|C0H413]
Expression and Regulation
Operons
genes
[gene|A16C6515D185E3A268D57D77F28EF7EF9AF9FE05|tepA]-[gene|A7C95C19ABD47456351C05A88B14F932BDEF1059|ylzJ]
description
[Pubmed|22383849]
regulation
expressed late during [wiki|sporulation] in the forespore ([protein|search|SigG], [wiki|SpoVT]) [Pubmed|23123912]
regulatory mechanism
[protein|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|spoVT]: repression, [Pubmed|23123912], in [regulon|protein:01EF886D3D004EA9B22AC5E75D50FF07D8631E68|spoVT regulon]
sigma factors
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|23123912], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|A16C6515D185E3A268D57D77F28EF7EF9AF9FE05|tepA]→[gene|A7C95C19ABD47456351C05A88B14F932BDEF1059|ylzJ]

2023-01-18 18:26:18

ghost

29

881067a6f0a1afd8c17c21d46442823bbbcc221d

65C3CDB44DB233763F0B479582509A5F32BD4D75

Biological materials
Mutant
BKE16799 ([gene|A7C95C19ABD47456351C05A88B14F932BDEF1059|ylzJ]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE16799 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CTGAGGCATCACGGTATAAA,  downstream forward: _UP4_TAAGAATCCAACCCTTTTTT
BKK16799 ([gene|A7C95C19ABD47456351C05A88B14F932BDEF1059|ylzJ]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK16799 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CTGAGGCATCACGGTATAAA,  downstream forward: _UP4_TAAGAATCCAACCCTTTTTT
References
22383849,23927687

A7C95C19ABD47456351C05A88B14F932BDEF1059

Page visits: 1574

Time of last update: 2023-02-01 19:39:47

Author of last update: Bzhu