yncC

At Gram+ 2022 in Prague, there will be a workshop on how to get the most out of SubtiWiki. We will present newly added features. Moreover, we hope to learn from you what you would like to have added to SubtiWiki to improve it!

yncC
168

similar to sugar transport protein

locus
BSU_17630
Molecular weight
45.58 kDa
pI
10.2
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yncC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2814

This gene is a member of the following regulons

Gene
Coordinates
1,896,424  1,897,839
The protein
Protein family
[wiki|major facilitator superfamily] (according to UniProt)
[wiki|Sugar transporter (TC 2.A.1.1) family] (according to UniProt)
Structure
[PDB|4LDS] (from Staphylococcus epidermidis, 36% identity) [pubmed|24127585]
[AF|P94493]
Paralogous protein(s)
[protein|0757FAEB38AA1C599C5067794AF83A4BA5912DC9|csbC], [protein|4A77316AA94F9C11DB70AB76711AACBD28098AA1|iolT], [protein|770D9A5BEEEABE9C3FC772E74001329206ECFAB3|araE], [protein|7CE5A42042E5D52768735E795DB805530691D8A6|ywtG], [protein|8B0701B5694ABA8142476CB896E590FE1981D7DB|yfiG]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|A84AC4E40E7C722E27AE9C24ACECFEABD51B57BE|yncC]
description
[Pubmed|22383849]
Open in new tab

[gene|A84AC4E40E7C722E27AE9C24ACECFEABD51B57BE|yncC]

2022-01-27 02:09:51

Jstuelk

6

6b0111069e5aab2389f0d0d5910360f2c50122f7

1C922E04D0885D3B90606DCD56564636A65205E5

Biological materials
Mutant
MGNA-B095 (yncC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1094 NBRP B. subtilis, Japan]
BKE17630 ([gene|A84AC4E40E7C722E27AE9C24ACECFEABD51B57BE|yncC]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE17630 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTCCCCTGCCTTTAAGA,  downstream forward: _UP4_TAAATATGTTGAAAATCTCT
BKK17630 ([gene|A84AC4E40E7C722E27AE9C24ACECFEABD51B57BE|yncC]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK17630 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTCCCCTGCCTTTAAGA,  downstream forward: _UP4_TAAATATGTTGAAAATCTCT
References
Research papers
24127585

A84AC4E40E7C722E27AE9C24ACECFEABD51B57BE

Page visits: 1100

Time of last update: 2022-05-19 16:02:35

Author of last update: Melvin.boenninger