SubtiWiki SubtiWiki
adeC
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

adeC
168

adenine deaminase

locus
BSU_14520
Molecular weight
62.64 kDa
pI
4.72
Protein length
Gene length
function
utilization of adenine as nitrogen source,purine salvage and interconversion
product
adenine deaminase
essential
no
ec
3.5.4.2
synonyms
adeC, ade, yzaD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1001

This gene is a member of the following regulons

Gene
Coordinates
1,521,351  1,523,084
The protein
Catalyzed reaction/ biological activity
Adenine + H2O --> hypoxanthine + NH3 (according to UniProt)
Protein family
[wiki|Metallo-dependent hydrolases superfamily] (according to UniProt)
Structure
[PDB|3NQB] (from Agrobacterium tumefaciens, 31% identity)
Expression and Regulation
Operons
genes
[gene|A85EB6E97AC9B2CA46BA6EF315BDA72A035DD3E7|adeC]
description
[pubmed|22383849]
Open in new tab

[gene|A85EB6E97AC9B2CA46BA6EF315BDA72A035DD3E7|adeC]

2021-09-18 05:52:22

Jstuelk

4

4d65ee88c34c4c66e5b22647b2f2d8f2e6d44425

42E493A8D604723A7E711548645C4701FEBD4586

Biological materials
Mutant
BKE14520 ([gene|A85EB6E97AC9B2CA46BA6EF315BDA72A035DD3E7|adeC]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE14520 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAATAGGCCCCTCCTTTTT,  downstream forward: _UP4_TAAAAAGAGGCACTCCCTTA
BKK14520 ([gene|A85EB6E97AC9B2CA46BA6EF315BDA72A035DD3E7|adeC]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK14520 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAATAGGCCCCTCCTTTTT,  downstream forward: _UP4_TAAAAAGAGGCACTCCCTTA
References
8550522

A85EB6E97AC9B2CA46BA6EF315BDA72A035DD3E7

Page visits: 1362

Time of last update: 2021-09-23 15:32:22

Author of last update: Melvin.boenninger