nasE

nasE
168

assimilatory nitrite reductase (subunit)

locus
BSU_03290
Molecular weight
11.76 kDa
pI
4.8
Protein length
Gene length
function
utilization of nitrite as nitrogen source
product
assimilatory nitrite reductase (subunit)
essential
no
ec
1.7.1.4
synonyms
nasE, nasBD, nirD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2146

This gene is a member of the following regulons

Gene
Coordinates
355,412  355,732
The protein
Catalyzed reaction/ biological activity
2 H2O + 3 NADP+ + NH4+ --> 5 H+ + 3 NADPH + nitrite  (according to UniProt)
2 H2O + 3 NAD+ + NH4+ --> 5 H+ + 3 NADH + nitrite (according to UniProt)
[wiki|Domains]
Rieske domain (aa 8-104) (according to UniProt)
[wiki|Cofactors]
NAD  [Pubmed|11289299]
FeS cluster [pubmed|29292548]
Structure
[PDB|5BOK] (from Diaphorobacter sp., 30% identity)
[AF|P42436]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|3F87227DC3371746B3823730B6A7024D348C151E|nasB]-[gene|EC8BF9A3BA88FE2A78C6F78A888E0D1E25C47BC5|nasC]-[gene|FAAC0F819AEC8E055CCEE86D93C8DE5584DC4B23|nasD]-[gene|A8998F46F68155A5C8AE2A2FBB95CA5A1635BB2B|nasE]-[gene|159A6D0D45B5F0F055228357FD9A3BF8E5A999E5|nasF]
description
[Pubmed|7836289]
regulation
''[protein|search|nasD]'': expressed under anaerobic conditions ([protein|search|ResD]) [Pubmed|10972836]
regulatory mechanism
[protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|resD]: activation, [Pubmed|10972836], in [regulon|protein:1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|resD regulon]
[protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA]: activation, [PubMed|8799114,9765565], in [regulon|protein:857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA regulon]
[protein|EC6697D5D945B7E5083AFED9218748763C443278|nsrR]: repression, [Pubmed|16885456], in [regulon|protein:EC6697D5D945B7E5083AFED9218748763C443278|nsrR regulon]
[protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|fur]: repression, [pubmed|12354229], in [regulon|protein:F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|fur regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|7836289], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|3F87227DC3371746B3823730B6A7024D348C151E|nasB]→[gene|159A6D0D45B5F0F055228357FD9A3BF8E5A999E5|nasF]

2022-11-28 20:04:48

ghost

35

f7e39891ce616efe86a59a87e70448f347bb9239

B3FDABF6DE6A38B053CBE30BA36088850B35E312

genes
[gene|FAAC0F819AEC8E055CCEE86D93C8DE5584DC4B23|nasD]-[gene|A8998F46F68155A5C8AE2A2FBB95CA5A1635BB2B|nasE]-[gene|159A6D0D45B5F0F055228357FD9A3BF8E5A999E5|nasF]
description
[Pubmed|9765565]
regulation
''[protein|search|nasD]'': expressed under anaerobic conditions ([protein|search|ResD]) [Pubmed|10972836]
Open in new tab

[gene|FAAC0F819AEC8E055CCEE86D93C8DE5584DC4B23|nasD]→[gene|159A6D0D45B5F0F055228357FD9A3BF8E5A999E5|nasF]

2022-11-20 05:31:15

ghost

24

5ad87c79ecdfd1b1041c676834950d8393689a20

E10C8C0393696A6DF68E202566914889ADC48A5C

Biological materials
Mutant
BKE03290 ([gene|A8998F46F68155A5C8AE2A2FBB95CA5A1635BB2B|nasE]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE03290 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTCCATTCCTCCTCAAT,  downstream forward: _UP4_TGATCAAAAGACCGGATCAC
BKK03290 ([gene|A8998F46F68155A5C8AE2A2FBB95CA5A1635BB2B|nasE]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK03290 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTCCATTCCTCCTCAAT,  downstream forward: _UP4_TGATCAAAAGACCGGATCAC
References
Reviews
22103536,11289299
Original Publications
12823818,7868621,8799114,9765565,10972836,16885456,21091510,24214949,25755103

A8998F46F68155A5C8AE2A2FBB95CA5A1635BB2B

Page visits: 1397

Time of last update: 2022-11-26 02:18:42

Author of last update: Melvin.boenninger