ycgH

ycgH
168

similar to amino acid transporter

locus
BSU_03110
Molecular weight
41.01 kDa
pI
9.25
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
ycgH

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1113

This gene is a member of the following regulons

Gene
Coordinates
336,092  337,432
The protein
Protein family
[wiki|amino acid-polyamine-organocation (APC) superfamily] (according to UniProt) [http://www.tcdb.org/search/result.php?tc=2.A.3 TC 2.A.3]
Structure
[PDB|6F2G] (from Carnobacterium sp., corresponds to aa 23 ... 230, 24.8% identity) [pubmed|31000719]
[AF|P94383]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|A8BDF98B66A2DC044FD60ED9CA15AD70B0840B87|ycgH]
description
[Pubmed|22383849]
regulation
expressed during [wiki|sporulation] [Pubmed|22383849]
Open in new tab

[gene|A8BDF98B66A2DC044FD60ED9CA15AD70B0840B87|ycgH]

2022-12-01 20:43:55

ghost

12

a792a8653ef26f1697fbddabb4d5a8de7cb4f73d

11C20761F3AE71417BF839E0048D83B67A61B2AF

Biological materials
Mutant
MGNA-B989 (ycgH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1988 NBRP B. subtilis, Japan]
BKE03110 ([gene|A8BDF98B66A2DC044FD60ED9CA15AD70B0840B87|ycgH]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE03110 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTATTTATTCAACCCCTT,  downstream forward: _UP4_AAAGATCGCCCTGCCAGTCC
BKK03110 ([gene|A8BDF98B66A2DC044FD60ED9CA15AD70B0840B87|ycgH]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK03110 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTATTTATTCAACCCCTT,  downstream forward: _UP4_AAAGATCGCCCTGCCAGTCC
References
22383849,31000719

A8BDF98B66A2DC044FD60ED9CA15AD70B0840B87

Page visits: 1135

Time of last update: 2022-12-02 01:43:32

Author of last update: Jstuelk