divIVA

divIVA
168

curvature sensitive membrane binding protein that recruits other proteins to the poles and the division septum, [wiki|cell division] initiation protein (septum placement), part of the Min system (with Z ring placement)

locus
BSU_15420
Molecular weight
19.20 kDa
pI
4.85
Protein length
Gene length
function
division site selection, chromosome segregation and control of peptidoglycan homeostasis
product
[wiki|cell division] initiation protein, member of the [wiki|divisome]
essential
no
synonyms
divIVA, ylmJ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG3599

This gene is a member of the following regulons

Gene
Coordinates
1,612,521  1,613,015
Phenotypes of a mutant
filamentation and polar divisions that in turn cause a minicell phenotype [pubmed|9219999]
moderate [pubmed|26735940] to severe [pubmed|11445541] [wiki|sporulation] defect
The protein
Catalyzed reaction/ biological activity
curvature sensitive membrane binding protein that recruits other proteins to the poles and the division septum
DivIVA is required for polar localisation of [protein|8C94C9598A823A8405B3E1FA0124E21D90845B8E|minC]-[protein|37DAD42A391E2FC506225EAF91B8F21629A401DF|minD] via [protein|C3482F13AE7B7462D9A4C91C8B461B7987A2277D|minJ]. [Pubmed|19019154]
It also recruits [protein|09E9194E82DF199527F414DB0EC15547A71AD25E|racA] to the distal pole of the prespore [Pubmed|12493822].
DivIVA may anchor [protein|7C8DFE00A2B2B30CC8BEB35055D92CC2E4128F3A|spoIIE] briefly to the assembling polar septum before [protein|7C8DFE00A2B2B30CC8BEB35055D92CC2E4128F3A|spoIIE] is subsequently released into the forespore membrane and recaptured at the polar septum [Pubmed|25101664]
required for the compartment-specific activation of [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF] [Pubmed|25101664]
activates [protein|23FF4A00C36EC1B7297F51A9EF3579B41F0B7EBA|prkC] [Pubmed|25845974]
required for oriC placement during spore development [Pubmed|27059541]
Protein family
DivIVA family (single member, according to UniProt)
[wiki|Domains]
the first 60 amino acids constitute a conserved lipid binding domain [Pubmed|30887576,19478798]
the C-terminal domain is less conserved
multimerisation involves two coiled-coil motifs, one in the lipid binding domain, and the other one being present in the helical C-terminal domain [Pubmed|18388125] [Pubmed|23264578]
[wiki|Cofactors]
not known
Structure
[PDB|2WUJ] (N-terminal domain) [Pubmed|20502438]
[AF|P71021]
Modification
phosphorylated on Arg-102 [Pubmed|22517742]
The ''Mycobacterium'' DivIVA homologue Wag31 is phosphorylated at T73 [Pubmed|15985609]
DivIVA from ''Streptococcus pneumoniae'' is phosphorylated at Threonine 201 by the Ser/Thr protein kinase Sktp1. [Pubmed|20453092][Pubmed|22211696]
Effectors of protein activity
not known
Paralogous protein(s)
[protein|C22F7704DC9D36D96FE089ADCEA546D7A3FB3739|gpsB]
[wiki|Localization]
DivIVA forms a ring underneath the invaginating membrane at the site of cell division and is enriched at both cell poles [Pubmed|9219999]
forms rings at the division septum and patches at the cell poles [Pubmed|22108385]
membrane targeting requires [protein|AD7CD451B4AE638A719C91780339784A7FF0F248|secA] [Pubmed|24592260]
assembles into a ring-like structure at the polar septum during [wiki|sporulation] [Pubmed|25101664]
mobility of [protein|A8C0C2B7BCA6FFFF3811402D683FB7B99F7120A4|divIVA] is reduced by its interaction with [protein|C3482F13AE7B7462D9A4C91C8B461B7987A2277D|minJ] [pubmed|35205323]
Additional information
about 1,700 molecules per cell [pubmed|33849976]
Expression and Regulation
Operons
genes
[gene|A8C0C2B7BCA6FFFF3811402D683FB7B99F7120A4|divIVA]
description
[Pubmed|16420366]
regulation
constitutively expressed [Pubmed|23701187]
regulatory mechanism
[protein|2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A]: repression, [Pubmed|14651647], in [regulon|protein:2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A regulon]
Open in new tab

[gene|A8C0C2B7BCA6FFFF3811402D683FB7B99F7120A4|divIVA]

2023-02-05 13:54:25

ghost

53

daf4849473e39b3c6161a6a0f73b8cfe3aa5fc00

B966EABA9A51355C0F0BD5882C0E3EC9A7ABDDE5

Biological materials
Mutant
4041 (''divIVA''::''tet''), available in [wiki|Leendert Hamoen]'s, [wiki|Jörg Stülke]'s, and [wiki|Sven Halbedel] 's lab
GP1482 (chromosomal ''divIVA''-Strep fusion, ''aphA''3), purification from ''B. subtilis'', for [wiki|SPINE], available in [wiki|Jörg Stülke]'s lab
BKE15420 ([gene|A8C0C2B7BCA6FFFF3811402D683FB7B99F7120A4|divIVA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE15420 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGATGCCACCTCCATTTT,  downstream forward: _UP4_TAAATTCTCTGATTATCTTG
BKK15420 ([gene|A8C0C2B7BCA6FFFF3811402D683FB7B99F7120A4|divIVA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK15420 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGATGCCACCTCCATTTT,  downstream forward: _UP4_TAAATTCTCTGATTATCTTG
Expression vectors
DivIVA-Strep available [http://www.rki.de/DE/Content/Institut/OrgEinheiten/Abt1/FG11/AG_LM.html here]
pGP1497 (N-terminal Strep-tag fused to C-terminus of ''divIVA'', TEV-site, purification from ''E. coli'', in [wiki|pGP172]), available in [wiki|Jörg Stülke]'s lab
two-hybrid system
''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([wiki|BACTH]), available in [wiki|Sven Halbedel]'s and [wiki|Jörg Stülke]'s labs
FLAG-tag construct
GP1776 (spc, based on [wiki|pGP1331]), available in [wiki|Jörg Stülke]'s lab
Antibody
A polyclonal anti-DivIVA antiserum generated in rabbit is described here [Pubmed|11445541].
GFP fusion
divIVA-gfp fusions available from the [http://subtiwiki.uni-goettingen.de/wiki/index.php/Leendert_Hamoen Hamoen] Lab
labs
[wiki|Leendert Hamoen], Centre for Bacterial Cell Biology, Newcastle upon Tyne, United Kingdom [http://www.ncl.ac.uk/camb/staff/profile/l.hamoen x]
[wiki|Imrich Barak], Slovak Academy of Science, Bratislava, Slovakia [http://imb.savba.sk/~barak/ homepage]
[wiki|Sven Halbedel], Robert Koch Institute [http://www.rki.de/DE/Content/Institut/OrgEinheiten/Abt1/FG11/AG_LM.html homepage]
References
Reviews
19654604,19884039,22722244,23182676,28697666,29355854,29522747,30887576,31405912,35081523,35638784
Original Publications
22582279,19654604,19666580,9219999,19019154,15554965,12368265,11445541,10835369,12511520,14651647,19478798,19429628,11445541,9219999,9045828,20352045,20502438,11886553,21564336,22108385,22457634,22517742,22661688,23264578,23701187,23927765,24391905,24592260,24600441,25101664,25845974,27059541,26735940,28674273,16885474,31821790,32762636,33849976,35205323,35499319,36445585

A8C0C2B7BCA6FFFF3811402D683FB7B99F7120A4

Page visits: 9320

Time of last update: 2023-02-08 01:09:35

Author of last update: Jstuelk