

cystine [wiki|ABC transporter] (binding protein)

Molecular weight
30.09 kDa
Protein length
Gene length
cystine uptake
cystine [wiki|ABC transporter] (binding protein)
tcyK, ytmK

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0834

This gene is a member of the following regulons

3,006,600  3,007,412
The protein
Protein family
[wiki|bacterial solute-binding protein 3 family] (according to UniProt)
Paralogous protein(s)
attached to the membrane via [protein|350C97E4A4C60A6E2FF9610D50B4A49FB9F9B42D|tcyL]-[protein|B1DD32A3B3D1C0C5391A40834940257357A2F30F|tcyM] [Pubmed|10092453]
Expression and Regulation
induced in the presence of methionine and taurine [Pubmed|11390694]
regulatory mechanism
[protein|50930C56C27D22715620A350220E3C56ADB41020|cymR]: repression, [Pubmed|16109943], in [regulon|protein:50930C56C27D22715620A350220E3C56ADB41020|cymR regulon]
[protein|741156D495BE3857683C8A0390764EAD83845ABC|ascR]: activation, [Pubmed|16109943], in [regulon|protein:741156D495BE3857683C8A0390764EAD83845ABC|ascR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|15272571], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab


2022-11-24 18:39:37





Biological materials
MGNA-A171 (ytmK::erm), available at the [ NBRP B. subtilis, Japan]
1A948 ( ''tcyK''::''kan''), [Pubmed|15262924], available at [ BGSC]
BKE29370 ([gene|A8FA40EACDB15CF53DDDA725A3AA5A6EB654FA8B|tcyK]::erm  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TTTCGTTTTCATCTCATCGC,  downstream forward: _UP4_TAGGTAAAAAGAGAGGGAGC
BKK29370 ([gene|A8FA40EACDB15CF53DDDA725A3AA5A6EB654FA8B|tcyK]::kan  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TTTCGTTTTCATCTCATCGC,  downstream forward: _UP4_TAGGTAAAAAGAGAGGGAGC


Page visits: 2017

Time of last update: 2022-11-29 16:07:51

Author of last update: Melvin.boenninger