yhdX

yhdX
168

unknown

locus
BSU_09630
Molecular weight
3.86 kDa
pI
10.23
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yhdX

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
1,038,653  1,038,760
The protein
Structure
[AF|O07593]
Expression and Regulation
Operons
genes
[gene|A925DB3A311C913412A4DF981F8811A0FF40D55F|yhdX]
description
[Pubmed|22383849]
Open in new tab

[gene|A925DB3A311C913412A4DF981F8811A0FF40D55F|yhdX]

2022-11-18 00:39:38

Jstuelk

10

dc3081438dd9762aa374afc14027cc52baba2401

A566BA978AA42B92733D8BBD1BA2C00A64C8C07F

Biological materials
Mutant
MGNA-A700 (yhdX::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/700 NBRP B. subtilis, Japan]
BKE09630 ([gene|A925DB3A311C913412A4DF981F8811A0FF40D55F|yhdX]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE09630 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGATCTCGCCTCCTTTTT,  downstream forward: _UP4_TGACTGTCCCTATTGAATCT
BKK09630 ([gene|A925DB3A311C913412A4DF981F8811A0FF40D55F|yhdX]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK09630 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGATCTCGCCTCCTTTTT,  downstream forward: _UP4_TGACTGTCCCTATTGAATCT
GP2573 ([gene|A925DB3A311C913412A4DF981F8811A0FF40D55F|yhdX]::tet comIQ12L) (in DK1042) available in [wiki|Jörg Stülke]'s lab

A925DB3A311C913412A4DF981F8811A0FF40D55F

Page visits: 854

Time of last update: 2022-12-01 10:48:36

Author of last update: Jstuelk