ykuI

ykuI
168

c-di-GMP binding protein

locus
BSU_14090
Molecular weight
47.80 kDa
pI
4.46
Protein length
Gene length
function
unknown
product
c-di-GMP binding protein
essential
no
synonyms
ykuI

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2200

This gene is a member of the following regulons

Gene
Coordinates
1,482,248  1,483,471
Phenotypes of a mutant
inactivation of ''[gene|A9C45C522EAF534C41CB75AA364A379E1D11055F|ykuI]'' confers resistance to high concentrations of Zn(II) [Pubmed|27935957]
The protein
[wiki|Domains]
EAL domain (aa 1-250) (according to UniPort)
PAS-like domain (aa 300-400)  [Pubmed|19244251]
Structure
[PDB|2BAS]
in complex with c-di-GMP [PDB|2W27]  [Pubmed|19244251]
[AF|O35014]
Expression and Regulation
Operons
genes
[gene|69E475F00D9CCFDDF086F0B8A5CBA81B31DD06FE|ykuH]-[gene|A9C45C522EAF534C41CB75AA364A379E1D11055F|ykuI]
description
[pubmed|22383849]
Open in new tab

[gene|69E475F00D9CCFDDF086F0B8A5CBA81B31DD06FE|ykuH]→[gene|A9C45C522EAF534C41CB75AA364A379E1D11055F|ykuI]

2022-12-20 22:07:27

Jstuelk

27

a784eabcc87f9f308361f5b2c0401d39f6550c21

D7FED4073B3EE38F94EC88F565073E2B99A283C1

Biological materials
Mutant
MGNA-A770 (ykuI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/770 NBRP B. subtilis, Japan]
GP1324 (tet), available in [wiki|Jörg Stülke]'s lab
BKE14090 ([gene|A9C45C522EAF534C41CB75AA364A379E1D11055F|ykuI]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE14090 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTATCACCTGCTTCTC,  downstream forward: _UP4_TAACGGCTGAAAGGCCGTTT
BKK14090 ([gene|A9C45C522EAF534C41CB75AA364A379E1D11055F|ykuI]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK14090 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTATCACCTGCTTCTC,  downstream forward: _UP4_TAACGGCTGAAAGGCCGTTT
References
23893111,19244251,22821967,27116468,27935957

A9C45C522EAF534C41CB75AA364A379E1D11055F

Page visits: 2427

Time of last update: 2023-02-02 08:59:21

Author of last update: Melvin.boenninger