yolD

yolD
168

unknown

locus
BSU_21510
Molecular weight
12.86 kDa
pI
4.75
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yolD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

The protein
Structure
[AF|O31991]
Paralogous protein(s)
[protein|94F2146AC6998CC77CD2E86CE8BE8DC98AEBB9CD|yozL], [protein|9BC3DF46C944A0FD5CAAB4513C4AF00EFC5FC8D5|yqjX]
Expression and Regulation
Operons
genes
[gene|A9D5625FF5F1A3845FF6F8A290F647CCA73D39EF|yolD]-[gene|BE8D5E038C0FD748C0F9C3F18DCA601BFFE8EA52|uvrX]
description
[Pubmed|16267290]
regulation
induced by DNA damage ([protein|search|LexA]) [Pubmed|16267290]
regulatory mechanism
[protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|lexA]: repression, [Pubmed|16267290], in [regulon|protein:D267AF38B0CF107042326E9B8F3DD3C9C85840E4|lexA regulon]
Open in new tab

[gene|A9D5625FF5F1A3845FF6F8A290F647CCA73D39EF|yolD]→[gene|BE8D5E038C0FD748C0F9C3F18DCA601BFFE8EA52|uvrX]

2022-11-27 09:57:48

ghost

25

75abea45b56916be6c2da15dea6c26c9903e3f54

4B3A377D69E222FC756C7EB6DE6DAB9836226A58

Biological materials
Mutant
BKE21510 ([gene|A9D5625FF5F1A3845FF6F8A290F647CCA73D39EF|yolD]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE21510 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATCGCCCCACTCCTTTA,  downstream forward: _UP4_AATAACATCATAGGAGTTAC
BKK21510 ([gene|A9D5625FF5F1A3845FF6F8A290F647CCA73D39EF|yolD]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK21510 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATCGCCCCACTCCTTTA,  downstream forward: _UP4_AATAACATCATAGGAGTTAC
References
16267290,30916324

A9D5625FF5F1A3845FF6F8A290F647CCA73D39EF

Page visits: 1102

Time of last update: 2022-12-01 15:30:58

Author of last update: Jstuelk