SubtiWiki SubtiWiki
gltB

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

gltB
168

small subunit of glutamate synthase

locus
BSU_18440
Molecular weight
54.78 kDa
pI
7.7
Protein length
Gene length
function
glutamate biosynthesis
product
glutamate synthase (small subunit)
essential
no
ec
1.4.1.13
synonyms
gltB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0493

This gene is a member of the following regulons

Gene
Coordinates
2,008,572  2,010,053
Phenotypes of a mutant
auxotrophic for glutamate
The protein
Catalyzed reaction/ biological activity
2 L-glutamate + NADP+ --> 2-oxoglutarate + H+ + L-glutamine + NADPH (according to UniProt)
Protein family
glutamate synthase family (with [protein|44DF1B7E476AD58B3CCC39300FFE0132D0D32AD0|gltA] and [protein|D1AF9DA2594D2E2A94DC207A870C8495954A7A17|yerD], according to UniProt)
[wiki|Domains]
nucleotide binding domain (NADP) (299313)
[wiki|Cofactors]
two 4Fe-4S clusters [https://www.biorxiv.org/content/10.1101/2021.04.12.439528v1 reference]
Structure
[PDB|2VDC] (the [protein|44DF1B7E476AD58B3CCC39300FFE0132D0D32AD0|gltA]-[protein|AA07CC52B2DD48ACC9D3375E9D531CB1ACBE485A|gltB] complex of ''Azospirillum brasiliense'') [Pubmed|18199747], note that B. subtilis [protein|44DF1B7E476AD58B3CCC39300FFE0132D0D32AD0|gltA] is unable to form dimers, thus [protein|44DF1B7E476AD58B3CCC39300FFE0132D0D32AD0|gltA]-[protein|AA07CC52B2DD48ACC9D3375E9D531CB1ACBE485A|gltB] exists as a heterodimer [pubmed|34931064]
[PDB|7MFT] (the [protein|C36C8C9EEDCAD392D9BEC9728A1E0CBFF2F4E790|gudB]6-([protein|44DF1B7E476AD58B3CCC39300FFE0132D0D32AD0|gltA]-[protein|AA07CC52B2DD48ACC9D3375E9D531CB1ACBE485A|gltB])6 complex) [pubmed|34931064]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|44DF1B7E476AD58B3CCC39300FFE0132D0D32AD0|gltA]-[gene|AA07CC52B2DD48ACC9D3375E9D531CB1ACBE485A|gltB]
description
[Pubmed|12823818]
regulation
expressed in the presence of ammonium [Pubmed|11029411]
regulatory mechanism
[protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA]: repression, [Pubmed|11029411], in [regulon|protein:857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA regulon]
[protein|87BCAE725B02860156D50E1783F6DB68510C811E|gltC]: activation, [Pubmed|2548995], in [regulon|protein:87BCAE725B02860156D50E1783F6DB68510C811E|gltC regulon]
[protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|fur]: indirect effect, in [regulon|protein:F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|fur regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|2548995], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|44DF1B7E476AD58B3CCC39300FFE0132D0D32AD0|gltA]→[gene|AA07CC52B2DD48ACC9D3375E9D531CB1ACBE485A|gltB]

2021-12-26 11:49:22

Bzhu

14

90b560615ccdd0da363a7f12dfb0b2af980e6000

F7C02591D79E87C32CC816954DB16451EB2276C9

Other regulations
[protein|CE542AE1A32CCD1ABB259E6159F7A37A8078E189|fsrA]: translation inhibition
Biological materials
Mutant
BP123 (Δ[gene|44DF1B7E476AD58B3CCC39300FFE0132D0D32AD0|gltA]-[gene|AA07CC52B2DD48ACC9D3375E9D531CB1ACBE485A|gltB]::''ermC'') , available in [wiki|Fabian Commichau]'s lab
GP807 (Δ[gene|44DF1B7E476AD58B3CCC39300FFE0132D0D32AD0|gltA]-[gene|AA07CC52B2DD48ACC9D3375E9D531CB1ACBE485A|gltB]::''tet'') , available in [wiki|Jörg Stülke]'s lab
GP517 (Δ[gene|AA07CC52B2DD48ACC9D3375E9D531CB1ACBE485A|gltB]::''ermC''), available in [wiki|Jörg Stülke]'s lab
BKE18440 ([gene|AA07CC52B2DD48ACC9D3375E9D531CB1ACBE485A|gltB]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE18440 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTCCTCTCCCCTTCCT,  downstream forward: _UP4_TAAATAAAGGGGATTATCAT
BKK18440 ([gene|AA07CC52B2DD48ACC9D3375E9D531CB1ACBE485A|gltB]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK18440 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTCCTCTCCCCTTCCT,  downstream forward: _UP4_TAAATAAAGGGGATTATCAT
Expression vectors
pGP1119 (in [wiki|pGP380], for SPINE, expression in ''B. subtilis''), available in [wiki|Jörg Stülke]'s lab [pubmed|20933603]
pGP3031: IPTG inducible expression, purification in ''E. coli'' with C-terminal His-tag, in [wiki|pGP574] (Strep-tag omitted), available in [wiki|Jörg Stülke]'s lab
pGP3032: IPTG inducible expression, purification in ''E. coli'' with C-terminal Strep-tag, in [wiki|pGP574], available in [wiki|Jörg Stülke]'s lab
two-hybrid system
''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([wiki|BACTH]), available in [wiki|Jörg Stülke]'s lab
lacZ fusion
see ''[gene|44DF1B7E476AD58B3CCC39300FFE0132D0D32AD0|gltA]
labs
[wiki|Linc Sonenshein], Tufts University, Boston, MA, USA [http://www.tufts.edu/sackler/microbiology/faculty/sonenshein/index.html Homepage]
[wiki|Fabian Commichau], Göttingen, Germany [http://www.uni-goettingen.de/de/413008.html homepage]
References
Reviews
16143852,12859215,22625175,12859215
Original Publications
27223617,12823818,20933603,11029411,7559360,15150225,2548995,17183217,17608797,17134717,14523131,12823818,18326565,18199747,22389480,25755103,28294562,29242163,34931064

AA07CC52B2DD48ACC9D3375E9D531CB1ACBE485A

Page visits: 2724

Time of last update: 2022-01-16 20:03:42

Author of last update: Jstuelk