

small subunit of glutamate synthase

Molecular weight
54.78 kDa
Protein length
Gene length
glutamate biosynthesis
glutamate synthase (small subunit)

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0493

This gene is a member of the following regulons

2,008,572  2,010,053
Phenotypes of a mutant
auxotrophic for glutamate
The protein
Catalyzed reaction/ biological activity
2 L-glutamate + NADP+ --> 2-oxoglutarate + H+ + L-glutamine + NADPH (according to UniProt)
Protein family
glutamate synthase family (with [protein|44DF1B7E476AD58B3CCC39300FFE0132D0D32AD0|gltA] and [protein|D1AF9DA2594D2E2A94DC207A870C8495954A7A17|yerD], according to UniProt)
nucleotide binding domain (NADP) (299313)
two 4Fe-4S clusters [ reference]
[PDB|2VDC] (the [protein|44DF1B7E476AD58B3CCC39300FFE0132D0D32AD0|gltA]-[protein|AA07CC52B2DD48ACC9D3375E9D531CB1ACBE485A|gltB] complex of ''Azospirillum brasiliense'') [Pubmed|18199747], note that B. subtilis [protein|44DF1B7E476AD58B3CCC39300FFE0132D0D32AD0|gltA] is unable to form dimers, thus [protein|44DF1B7E476AD58B3CCC39300FFE0132D0D32AD0|gltA]-[protein|AA07CC52B2DD48ACC9D3375E9D531CB1ACBE485A|gltB] exists as a heterodimer [pubmed|34931064]
[PDB|7MFT] (the [protein|C36C8C9EEDCAD392D9BEC9728A1E0CBFF2F4E790|gudB]6-([protein|44DF1B7E476AD58B3CCC39300FFE0132D0D32AD0|gltA]-[protein|AA07CC52B2DD48ACC9D3375E9D531CB1ACBE485A|gltB])6 complex) [pubmed|34931064]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
expressed in the presence of ammonium [Pubmed|11029411]
regulatory mechanism
[protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA]: repression, [Pubmed|11029411], in [regulon|protein:857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA regulon]
[protein|87BCAE725B02860156D50E1783F6DB68510C811E|gltC]: activation, [Pubmed|2548995], in [regulon|protein:87BCAE725B02860156D50E1783F6DB68510C811E|gltC regulon]
[protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|fur]: indirect effect, in [regulon|protein:F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|fur regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|2548995], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab


2022-11-29 22:13:57





Other regulations
[protein|CE542AE1A32CCD1ABB259E6159F7A37A8078E189|fsrA]: translation inhibition
Biological materials
BP123 (Δ[gene|44DF1B7E476AD58B3CCC39300FFE0132D0D32AD0|gltA]-[gene|AA07CC52B2DD48ACC9D3375E9D531CB1ACBE485A|gltB]::''ermC'') , available in [wiki|Fabian Commichau]'s lab
GP807 (Δ[gene|44DF1B7E476AD58B3CCC39300FFE0132D0D32AD0|gltA]-[gene|AA07CC52B2DD48ACC9D3375E9D531CB1ACBE485A|gltB]::''tet'') , available in [wiki|Jörg Stülke]'s lab
GP517 (Δ[gene|AA07CC52B2DD48ACC9D3375E9D531CB1ACBE485A|gltB]::''ermC''), available in [wiki|Jörg Stülke]'s lab
BKE18440 ([gene|AA07CC52B2DD48ACC9D3375E9D531CB1ACBE485A|gltB]::erm  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTCCTCTCCCCTTCCT,  downstream forward: _UP4_TAAATAAAGGGGATTATCAT
BKK18440 ([gene|AA07CC52B2DD48ACC9D3375E9D531CB1ACBE485A|gltB]::kan  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTCCTCTCCCCTTCCT,  downstream forward: _UP4_TAAATAAAGGGGATTATCAT
Expression vectors
pGP1119 (in [wiki|pGP380], for SPINE, expression in ''B. subtilis''), available in [wiki|Jörg Stülke]'s lab [pubmed|20933603]
pGP3031: IPTG inducible expression, purification in ''E. coli'' with C-terminal His-tag, in [wiki|pGP574] (Strep-tag omitted), available in [wiki|Jörg Stülke]'s lab
pGP3032: IPTG inducible expression, purification in ''E. coli'' with C-terminal Strep-tag, in [wiki|pGP574], available in [wiki|Jörg Stülke]'s lab
two-hybrid system
''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([wiki|BACTH]), available in [wiki|Jörg Stülke]'s lab
lacZ fusion
see ''[gene|44DF1B7E476AD58B3CCC39300FFE0132D0D32AD0|gltA]
[wiki|Linc Sonenshein], Tufts University, Boston, MA, USA [ Homepage]
[wiki|Fabian Commichau], Göttingen, Germany [ homepage]
Original Publications


Page visits: 3178

Time of last update: 2022-11-30 02:02:52

Author of last update: Jstuelk