lplB

lplB
168

transmembrane lipoprotein, putative [wiki|ABC transporter] (permease)

locus
BSU_07110
Molecular weight
36.42 kDa
pI
9.31
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
lplB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG4209

This gene is a member of the following regulons

Gene
Coordinates
781,092  782,048
The protein
Protein family
[wiki|Binding-protein-dependent transport system permease family] (according to UniProt)
[wiki|MalFG subfamily] (according to UniProt)
[wiki|Domains]
[wiki|ABC transmembrane type-1 domain] (aa 90-305) (according to UniProt)
Structure
[PDB|4TQU] (from Sphingomonas sp., 40% identity) [pubmed|26235029]
[AF|P39128]
Paralogous protein(s)
[protein|4ED1DD17694A06CFDFF48943BAE8AEC2CCCB0401|yteP]
[wiki|Localization]
cell membrane [Pubmed|10092453]
Biological materials
Mutant
BKE07110 ([gene|AA19541BCCAE08B48BD23F4E8337EBA220E5C4EF|lplB]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE07110 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATCTGTTCTCCTTTCGT,  downstream forward: _UP4_GGATTGTTTTAGAGGAGGGA
BKK07110 ([gene|AA19541BCCAE08B48BD23F4E8337EBA220E5C4EF|lplB]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK07110 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATCTGTTCTCCTTTCGT,  downstream forward: _UP4_GGATTGTTTTAGAGGAGGGA
References
10092453,26235029

AA19541BCCAE08B48BD23F4E8337EBA220E5C4EF

Page visits: 1332

Time of last update: 2022-11-27 09:01:21

Author of last update: Melvin.boenninger