sacB
168
levansucrase
locus
BSU_34450
Molecular weight
52.80 kDa
pI
6.18
function
utilization of sucrose, production of levan
product
levansucrase
essential
no
ec
2.4.1.10
synonyms
sacB
Outlinks
Genomic Context
Categories containing this gene/protein
List of homologs in different organisms
This gene is a member of the following regulons
Gene
Coordinates
3,536,012 3,537,433
Phenotypes of a mutant
defective in tomato root colonization in the presence of sucrose [pubmed|33772107]
The protein
Catalyzed reaction/ biological activity
[6)-β-D-fructofuranosyl-(2→](n) α-D-glucopyranoside + sucrose --> [6)-β-D-fructofuranosyl-(2→](n+1) α-D-glucopyranoside + D-glucose (according to UniProt)
Protein family
glycosyl hydrolase 68 family (single member, according to UniProt)
Structure
[PDB|1PT2] (complex with sucrose), [PDB|1OYG]
[AF|P05655]
[wiki|Localization]
secreted (according to Swiss-Prot), extracellular (signal peptide) [Pubmed|18957862]
Expression and Regulation
Operons
genes
[gene|AAA944BE7F01CE90F7730EECA16F3E4ED77D165A|sacB]-[gene|33BEC05F2129EBAF6699E847B0909A5A48F0E869|levB]
description
[Pubmed|11739774]
regulation
the [wiki|RNA switch] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
regulatory mechanism
[protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU]: activation, [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU]-P, [Pubmed|2428811], in [regulon|protein:D343D2096664A972026D911E7A17A35C7B1CD1C9|degU regulon]
[protein|EB330AB3DC6C8C3EC72C4CAFA2BC59CC485EE344|sacY]: antitermination, /antitermination via binding to a [wiki|RNA switch], in [regulon|protein:EB330AB3DC6C8C3EC72C4CAFA2BC59CC485EE344|sacY regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|2428811], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Biological materials
Mutant
BKE34450 ([gene|AAA944BE7F01CE90F7730EECA16F3E4ED77D165A|sacB]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE34450 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTTCATGTCTCCTTTT, downstream forward: _UP4_TAAAAACGCAAAAGAAAATG
BKK34450 ([gene|AAA944BE7F01CE90F7730EECA16F3E4ED77D165A|sacB]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK34450 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTTCATGTCTCCTTTT, downstream forward: _UP4_TAAAAACGCAAAAGAAAATG
lacZ fusion
pGP564 (in [wiki|pAC7]), a series of RAT mutations in [wiki|pAC7], all available in [wiki|Jörg Stülke]'s lab
References
Reviews
Original Publications
Page visits: 26468
Time of last update: 2025-10-28 15:25:20
Author of last update: Jstuelk