sacB

sacB
168

levansucrase

locus
BSU_34450
Molecular weight
52.80 kDa
pI
6.18
Protein length
Gene length
function
utilization of sucrose, production of levan
product
levansucrase
essential
no
ec
2.4.1.10
synonyms
sacB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
3,536,012  3,537,433
Phenotypes of a mutant
defective in tomato root colonization in the presence of sucrose [pubmed|33772107]
The protein
Catalyzed reaction/ biological activity
[6)-β-D-fructofuranosyl-(2→](n) α-D-glucopyranoside + sucrose --> [6)-β-D-fructofuranosyl-(2→](n+1) α-D-glucopyranoside + D-glucose (according to UniProt)
Protein family
glycosyl hydrolase 68 family (single member, according to UniProt)
Structure
[PDB|1PT2] (complex with sucrose),  [PDB|1OYG]
[AF|P05655]
[wiki|Localization]
secreted (according to Swiss-Prot),  extracellular (signal peptide) [Pubmed|18957862]
Expression and Regulation
Operons
genes
[gene|AAA944BE7F01CE90F7730EECA16F3E4ED77D165A|sacB]-[gene|33BEC05F2129EBAF6699E847B0909A5A48F0E869|levB]
description
[Pubmed|11739774]
regulation
the [wiki|RNA switch] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
regulatory mechanism
[protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU]: activation, [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU]-P, [Pubmed|2428811], in [regulon|protein:D343D2096664A972026D911E7A17A35C7B1CD1C9|degU regulon]
[protein|EB330AB3DC6C8C3EC72C4CAFA2BC59CC485EE344|sacY]: antitermination, /antitermination via binding to a [wiki|RNA switch], in [regulon|protein:EB330AB3DC6C8C3EC72C4CAFA2BC59CC485EE344|sacY regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|2428811], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|AAA944BE7F01CE90F7730EECA16F3E4ED77D165A|sacB]→[gene|33BEC05F2129EBAF6699E847B0909A5A48F0E869|levB]

2022-11-23 06:26:28

Jstuelk

22

045fcc2eb89a1dc92a1a5a36944dc7ec173ff1cf

738CCB0FCDEF80A5E71672A01EA171EF191FFE25

Biological materials
Mutant
BKE34450 ([gene|AAA944BE7F01CE90F7730EECA16F3E4ED77D165A|sacB]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE34450 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCGTTCATGTCTCCTTTT,  downstream forward: _UP4_TAAAAACGCAAAAGAAAATG
BKK34450 ([gene|AAA944BE7F01CE90F7730EECA16F3E4ED77D165A|sacB]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK34450 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCGTTCATGTCTCCTTTT,  downstream forward: _UP4_TAAAAACGCAAAAGAAAATG
lacZ fusion
pGP564 (in [wiki|pAC7]), a series of RAT mutations in [wiki|pAC7], all available in [wiki|Jörg Stülke]'s lab
References
Reviews
20735481
Original Publications
6402497,2428811,18197985,18957862,2105292,11739774,3039303,22247149,26256357,26600431,26646447,28871528,29131629,28433290,29794222,30301900,30703417,32553967,33303628,33772107

AAA944BE7F01CE90F7730EECA16F3E4ED77D165A

Page visits: 20773

Time of last update: 2022-11-29 05:04:24

Author of last update: Jstuelk