iolC

At Gram+ 2022 in Prague, there will be a workshop on how to get the most out of SubtiWiki. We will present newly added features. Moreover, we hope to learn from you what you would like to have added to SubtiWiki to improve it!

iolC
168

formation of 2-deoxy-5-keto-gluconic acid-6-phosphate (5th reaction)

locus
BSU_39740
Molecular weight
35.48 kDa
pI
4.78
Protein length
Gene length
function
myo-inositol catabolism
product
formation of 2-deoxy-5-keto-gluconic acid-6-phosphate (5th reaction)
essential
no
ec
2.7.1.92
synonyms
iolC, yxdC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0524

This gene is a member of the following regulons

Gene
Coordinates
4,081,029  4,082,006
The protein
Catalyzed reaction/ biological activity
5-dehydro-2-deoxy-D-gluconate + ATP --> 6-phospho-5-dehydro-2-deoxy-D-gluconate + ADP + H+ (according to UniProt)
Protein family
[wiki|carbohydrate kinase PfkB family] (according to UniProt)
Structure
[PDB|2QCV] (from ''Bacillus halodurans c-125 mutant'', 73% identity, 85% similarity)
[AF|P42414]
Expression and Regulation
Operons
genes
[gene|762718A15E5256261D79DF60F9106AF0CE2D60C6|iolA]-[gene|0903CCBE053230998A9123F3269868E952C0F76B|iolB]-[gene|AAE60753464EAA32379521531FDCAF64534D5F40|iolC]-[gene|AA79B6F039EC5B79F4419A5F358AE5AE8292E731|iolD]-[gene|C31AF6C8050D453D9011B0793403791F1851BA69|iolE]-[gene|14813DE6C6DF7AB031BA05AED7D31AE9E8F8498E|iolF]-[gene|93C1DF93CAFC5AE726523A91A3BA7470017FF6DC|iolG]-[gene|FD64E9D00BB03B510C7F7CA3935558A2195532A9|iolH]-[gene|2742FCE60AA87B2BE5A0B5C34F617E10DDE7F126|iolI]-[gene|1EFB5C8F28146D1EA3B615F548D0CF262D2B4DF5|iolJ]
description
[Pubmed|9226270]
regulation
induced by inositol ([protein|search|IolR]) [Pubmed|9887260,9226270]
regulatory mechanism
[protein|5F4ABBC8ECAD6F6C10EC39B2B0F0BC73F11522CE|iolR]: repression, [Pubmed|9887260,9226270], in [regulon|protein:5F4ABBC8ECAD6F6C10EC39B2B0F0BC73F11522CE|iolR regulon]
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|10666464], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|9226270], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|762718A15E5256261D79DF60F9106AF0CE2D60C6|iolA]→[gene|1EFB5C8F28146D1EA3B615F548D0CF262D2B4DF5|iolJ]

2022-04-28 01:52:36

ghost

20

4fd092965338ef1511600132442d2247a2693c98

C19E63046F0B412961D2626F72E0308D922D50B2

Biological materials
Mutant
MGNA-B772 (iolC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1771 NBRP B. subtilis, Japan]
BKE39740 ([gene|AAE60753464EAA32379521531FDCAF64534D5F40|iolC]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE39740 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCGTAAACAGCCACTCCT,  downstream forward: _UP4_TAATTGAAAAAGATCGAGTA
BKK39740 ([gene|AAE60753464EAA32379521531FDCAF64534D5F40|iolC]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK39740 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCGTAAACAGCCACTCCT,  downstream forward: _UP4_TAATTGAAAAAGATCGAGTA
labs
[wiki|Yasutaro Fujita], University of Fukuyama, Japan
[[Ken-ichi Yoshida]], Kobe University, Japan
References
9226270,18310071,9887260,18310071

AAE60753464EAA32379521531FDCAF64534D5F40

Page visits: 1234

Time of last update: 2022-05-19 07:18:38

Author of last update: Melvin.boenninger