SubtiWiki SubtiWiki
spoIVFA

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

spoIVFA
168

inhibitor of [protein|8801B095C2CE36F3E0B9DBBF489FFB217087DC0A|spoIVFB] metalloprotease

locus
BSU_27980
Molecular weight
29.46 kDa
pI
7.29
Protein length
Gene length
function
control of [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK] activation
product
inhibitor of [protein|8801B095C2CE36F3E0B9DBBF489FFB217087DC0A|spoIVFB] metalloprotease
essential
no
synonyms
spoIVFA, bofB, spoVL

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5833

This gene is a member of the following regulons

Gene
Coordinates
2,856,832  2,857,626
The protein
[wiki|Domains]
the ectodomain of [protein|AB2A3422277040107AAF90358BBE58608F8E0738|spoIVFA] is cleaved off by [protein|DBB3ED60A7D162B9F2830F81041BC661AA5EC1E7|spoIVB] (first cleavage) [Pubmed|24243021]
the domains that inhibits [protein|8801B095C2CE36F3E0B9DBBF489FFB217087DC0A|spoIVFB] is cleaved off by [protein|85247AD09B7A472607B32D57E6318BA6C83EC6BA|ctpB] (second cleavage) [Pubmed|24243021]
[wiki|Localization]
integral mother cell membrane protein [Pubmed|24243021,11959848]
Expression and Regulation
Operons
genes
[gene|AB2A3422277040107AAF90358BBE58608F8E0738|spoIVFA]-[gene|8801B095C2CE36F3E0B9DBBF489FFB217087DC0A|spoIVFB]
description
[Pubmed|1942049]
regulation
expressed early during sporulation in the mother cell ([protein|search|SigE], [wiki|SpoIIID]) [Pubmed|15699190,1942049,15383836]
regulatory mechanism
[protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|spoIIID]: repression, [Pubmed|15383836], in [regulon|protein:90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|spoIIID regulon]
sigma factors
[protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE]: sigma factor, [Pubmed|15699190,1942049], in [regulon|protein:3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE regulon]
additional information
the domains that inhibits [protein|search|SpoIVFB] is cleaved off by [protein|search|CtpB] (second cleavage) [PubMed|24243021]
Open in new tab

[gene|AB2A3422277040107AAF90358BBE58608F8E0738|spoIVFA]→[gene|8801B095C2CE36F3E0B9DBBF489FFB217087DC0A|spoIVFB]

2021-11-18 12:15:54

ghost

7

1e707d7d278101558953739cad5b8518a0b41b6f

06855E0F0D4DD201392A356E8A25510E179CA137

genes
[gene|AB2A3422277040107AAF90358BBE58608F8E0738|spoIVFA]-[gene|8801B095C2CE36F3E0B9DBBF489FFB217087DC0A|spoIVFB]-[gene|11927EB0448839D047EC7BF70EC65156DAB481D3|rplU]-[gene|B27548A4BBF396C9BA102A80ACB08B21262CEA30|prp]-[gene|4626C659D6F1A81CCC94030F1CBAF7FEC3DE19CA|rpmA]
description
[Pubmed|22383849]
regulation
expressed early during sporulation in the mother cell ([protein|search|SigE], [wiki|SpoIIID]) [Pubmed|15699190,1942049,15383836]
additional information
the domains that inhibits [protein|search|SpoIVFB] is cleaved off by [protein|search|CtpB] (second cleavage) [PubMed|24243021]
Open in new tab

[gene|AB2A3422277040107AAF90358BBE58608F8E0738|spoIVFA]→[gene|4626C659D6F1A81CCC94030F1CBAF7FEC3DE19CA|rpmA]

2021-12-20 00:12:06

ghost

18

08f2f6d702f3f60218799ff9efc97a2139d25593

976520A55B5743F327D2763CEA04F353CE09CEE1

Biological materials
Mutant
BKE27980 ([gene|AB2A3422277040107AAF90358BBE58608F8E0738|spoIVFA]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27980 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTGCCATCATCCTTTGCA,  downstream forward: _UP4_ATTGATCCGATTCAGGTGAT
BKK27980 ([gene|AB2A3422277040107AAF90358BBE58608F8E0738|spoIVFA]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27980 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTGCCATCATCCTTTGCA,  downstream forward: _UP4_ATTGATCCGATTCAGGTGAT
References
Reviews
31350897,33538382
Original Publications
11959848,9501233,1577688,15292188,2115401,12940997,9078383,15752199,16818230,15699190,1942049,15383836,17557826,24243021,22383849,30403663

AB2A3422277040107AAF90358BBE58608F8E0738

Page visits: 1434

Time of last update: 2022-01-18 23:35:53

Author of last update: Jstuelk