

ribose [wiki|ABC transporter] (ATP-binding protein)

Molecular weight
54.36 kDa
Protein length
Gene length
ribose uptake
ribose [wiki|ABC transporter] (ATP-binding protein)

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1129

This gene is a member of the following regulons

3,703,682  3,705,163
The protein
Catalyzed reaction/ biological activity
ATP + D-ribose + H2O --> ADP + D-ribose + H+ + phosphate (according to UniProt)
Protein family
[wiki|ABC transporter superfamily] (according to UniProt)
2 [wiki|ABC transporter domain]s (aa 3-239, aa 246-493) (according to UniProt)
[PDB|1G9X] (from Methanocaldococcus jannaschii, 36% identity) [pubmed|12554933]
Paralogous protein(s)
attached to the cell membrane (via [protein|F1258E31151E137A850811B0C851D473CEFFD43B|rbsC]-[protein|F0E6F191FAF8F279462B09BF1FE4C6C752A57803|rbsD]) [Pubmed|10092453]
Expression and Regulation
expressed upon transition into the stationary phase ([protein|search|AbrB]) [Pubmed|7592460]
regulatory mechanism
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|7921236], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: activation, [Pubmed|7592460], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|7511775], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab


2022-12-09 06:55:09





Biological materials
BKE35940 ([gene|AB4A686F62550F90F5BD8D27DAADC9C33F1DA1DB|rbsA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE35940 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AATCTGCATGTTTCATCTTC,  downstream forward: _UP4_ACACTTGCCACGGGAGGGCG
BKK35940 ([gene|AB4A686F62550F90F5BD8D27DAADC9C33F1DA1DB|rbsA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK35940 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AATCTGCATGTTTCATCTTC,  downstream forward: _UP4_ACACTTGCCACGGGAGGGCG


Page visits: 2226

Time of last update: 2022-12-08 09:12:49

Author of last update: Melvin.boenninger