SubtiWiki SubtiWiki
rbsA

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

rbsA
168

ribose [wiki|ABC transporter] (ATP-binding protein)

locus
BSU_35940
Molecular weight
54.36 kDa
pI
6.18
Protein length
Gene length
function
ribose uptake
product
ribose [wiki|ABC transporter] (ATP-binding protein)
essential
no
ec
3.6.3.17
synonyms
rbsA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1129

This gene is a member of the following regulons

Gene
Coordinates
3,703,682  3,705,163
The protein
Catalyzed reaction/ biological activity
ATP + D-ribose + H2O --> ADP + D-ribose + H+ + phosphate (according to UniProt)
Protein family
[wiki|ABC transporter superfamily] (according to UniProt)
[wiki|Domains]
2 [wiki|ABC transporter domain]s (aa 3-239, aa 246-493) (according to UniProt)
Structure
[PDB|1G9X] (from Methanocaldococcus jannaschii, 36% identity) [pubmed|12554933]
Paralogous protein(s)
[protein|71546D1508EF17A208332E162CAE2C299987A569|nupO]
[wiki|Localization]
attached to the cell membrane (via [protein|F1258E31151E137A850811B0C851D473CEFFD43B|rbsC]-[protein|F0E6F191FAF8F279462B09BF1FE4C6C752A57803|rbsD]) [Pubmed|10092453]
Expression and Regulation
Operons
genes
[gene|77AEAC0F06B4D5F062D4A2740794B7BFDDA31096|rbsR]-[gene|C229BD2C00B169CF4A99482E65B3F749AD9D51D8|rbsK]-[gene|F0E6F191FAF8F279462B09BF1FE4C6C752A57803|rbsD]-[gene|AB4A686F62550F90F5BD8D27DAADC9C33F1DA1DB|rbsA]-[gene|F1258E31151E137A850811B0C851D473CEFFD43B|rbsC]-[gene|1D67888E79B09956F9258F4068546D8C67103549|rbsB]
description
[Pubmed|7921236]
regulation
expressed upon transition into the stationary phase ([protein|search|AbrB]) [Pubmed|7592460]
regulatory mechanism
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|7921236], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: activation, [Pubmed|7592460], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|7511775], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|77AEAC0F06B4D5F062D4A2740794B7BFDDA31096|rbsR]→[gene|1D67888E79B09956F9258F4068546D8C67103549|rbsB]

2021-12-01 14:39:37

ghost

10

ecd23e67fb36c12e46381b0bbd805e52a3ac9a7b

9A76230F5BF071D52DFA7084300C0507E658DAA8

Biological materials
Mutant
BKE35940 ([gene|AB4A686F62550F90F5BD8D27DAADC9C33F1DA1DB|rbsA]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35940 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AATCTGCATGTTTCATCTTC,  downstream forward: _UP4_ACACTTGCCACGGGAGGGCG
BKK35940 ([gene|AB4A686F62550F90F5BD8D27DAADC9C33F1DA1DB|rbsA]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35940 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AATCTGCATGTTTCATCTTC,  downstream forward: _UP4_ACACTTGCCACGGGAGGGCG
References
10092453,16872404,7511775,7592460,7921236,12554933

AB4A686F62550F90F5BD8D27DAADC9C33F1DA1DB

Page visits: 1563

Time of last update: 2022-01-13 01:18:21

Author of last update: Melvin.boenninger