purA

purA
168

adenylosuccinate synthetase

locus
BSU_40420
Molecular weight
47.51 kDa
pI
5.46
Protein length
Gene length
function
purine biosynthesis
product
adenylosuccinate synthetase
essential
no
ec
6.3.4.4
synonyms
purA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0104

This gene is a member of the following regulons

Gene
Coordinates
4,155,433 4,156,725
The protein
Catalyzed reaction/ biological activity
GTP + IMP + L-aspartate --> GDP + 2 H+ + N6-(1,2-dicarboxyethyl)-AMP + phosphate (according to UniProt)
Protein family
adenylosuccinate synthetase family (single member, according to UniProt)
Structure
[PDB|1KJX] (from ''Escherichia coli k12'', 46% identity, 64% similarity) [Pubmed|11741996]
[AF|P29726]
Modification
phosphorylated on Arg-97 [Pubmed|22517742]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Additional information
belongs to the 100 most abundant proteins [PubMed|15378759]
Expression and Regulation
Operons
genes
[gene|AB4B8B7325A1BF444D841EF1BBBCEC2D506AE600|purA]
description
[Pubmed|1312531]
regulation
expression activated by glucose (4.9 fold) ([protein|search|CcpA]) [Pubmed|12850135]
regulatory mechanism
[protein|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|purR]: repression, [Pubmed|7638212], in [regulon|protein:A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|purR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|1312531], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|AB4B8B7325A1BF444D841EF1BBBCEC2D506AE600|purA]

2022-09-19 13:00:19

ghost

9

7be4579d3311ce9ff90d905b45d6cc86e7ad6cfe

1532A476F292DF14E49CE718A58ED75916B270E2

genes
[gene|CA7C472698CB9B9D75573377F42CCEE055D73EDD|yycE]-[gene|AB4B8B7325A1BF444D841EF1BBBCEC2D506AE600|purA]
description
[Pubmed|22383849]
Open in new tab

[gene|CA7C472698CB9B9D75573377F42CCEE055D73EDD|yycE]→[gene|AB4B8B7325A1BF444D841EF1BBBCEC2D506AE600|purA]

2022-04-29 17:10:09

Jstuelk

18

4a912c55b3406aa5ba6f1c5c8e433c424892e12d

AFBAF653829816EA925A4E727CC7A8D893DA8987

Biological materials
Mutant
BKE40420 ([gene|AB4B8B7325A1BF444D841EF1BBBCEC2D506AE600|purA]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE40420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCCGTGCACCTCCGTT, downstream forward: _UP4_TAAATAGAATATGTCTGCAA
BKK40420 ([gene|AB4B8B7325A1BF444D841EF1BBBCEC2D506AE600|purA]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK40420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCCGTGCACCTCCGTT, downstream forward: _UP4_TAAATAGAATATGTCTGCAA
References
1722815,1312531,7638212,12850135,21424839,22517742,15378759,27234879,30974118

AB4B8B7325A1BF444D841EF1BBBCEC2D506AE600

Page visits: 2620

Time of last update: 2022-10-03 22:25:04

Author of last update: Melvin.boenninger