guaA

guaA
168

GMP synthetase (glutamine-hydrolysing)

locus
BSU_06360
Molecular weight
57.78 kDa
pI
4.75
Protein length
Gene length
function
biosynthesis of GMP
product
GMP synthetase (glutamine-hydrolysing)
essential
no
ec
6.3.5.2
synonyms
guaA, guaB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0519

This gene is a member of the following regulons

Gene
Coordinates
692,740 694,281
Phenotypes of a mutant
the mutant cells are thinner and shorter than wild type cells [pubmed|34846166]
The protein
Catalyzed reaction/ biological activity
ATP + H2O + L-glutamine + XMP --> AMP + diphosphate + GMP + 2 H+ + L-glutamate (according to UniProt)
[wiki|Domains]
[wiki|Glutamine amidotransferase type-1 domain] (aa 8-198) (according to UniProt)
GMPS ATP-PPase domain (aa 199-388) (according to UniProt)
Structure
[PDB|2YWB] (from ''Thermus thermophilus hb8'', 45% identity, 57% similarity)
[AF|P29727]
Effectors of protein activity
the enzyme is inhibited by guanosine tetraphosphate ([wiki|stringent response]) [Pubmed|409404]
Additional information
belongs to the 100 most abundant proteins [PubMed|15378759]
Expression and Regulation
Operons
genes
[gene|AC67305E4C165CC1D785E49B7CD8335346134376|guaA]
description
[Pubmed|1312531]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|1312531], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|AC67305E4C165CC1D785E49B7CD8335346134376|guaA]

2022-09-18 04:55:44

ghost

13

60bc067a64b6603e89a2cb6f8ff01643ce151cee

E0021F2C324204ED4ECA9CE4BD0E3981F0237FC3

Biological materials
Mutant
MGNA-A918 (yebB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/918 NBRP B. subtilis, Japan]
BKE06360 ([gene|AC67305E4C165CC1D785E49B7CD8335346134376|guaA]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE06360 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGTTGTCACCTAATCTC, downstream forward: _UP4_TAAGAATCAATTAATGGAAA
BKK06360 ([gene|AC67305E4C165CC1D785E49B7CD8335346134376|guaA]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK06360 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGTTGTCACCTAATCTC, downstream forward: _UP4_TAAGAATCAATTAATGGAAA
Expression vectors
pGP2898: expression of Strep-''guaA'' by [wiki|pGP380] in ''B. subtilis'' suitable for [wiki|SPINE], available in [wiki|Jörg Stülke]'s lab
References
Reviews
11395405
Original Publications
1722815,1312531,409404,15378759,24682323,27120414,30974118,34846166

AC67305E4C165CC1D785E49B7CD8335346134376

Page visits: 1468

Time of last update: 2022-10-02 16:29:41

Author of last update: Jstuelk