guaA
168
GMP synthetase (glutamine-hydrolysing)
locus
BSU_06360
Molecular weight
57.78 kDa
pI
4.75
function
biosynthesis of GMP
product
GMP synthetase (glutamine-hydrolysing)
essential
no
ec
6.3.5.2
synonyms
guaA, guaB
Outlinks
Genomic Context
Categories containing this gene/protein
List of homologs in different organisms, belongs to COG0519 (Galperin et al., 2021)
This gene is a member of the following regulons
Gene
Coordinates
692,740 694,281
Phenotypes of a mutant
the mutant cells are thinner and shorter than wild type cells [pubmed|34846166]
The protein
Catalyzed reaction/ biological activity
ATP + H2O + L-glutamine + XMP --> AMP + diphosphate + GMP + 2 H+ + L-glutamate (according to UniProt)
[wiki|Domains]
[wiki|Glutamine amidotransferase type-1 domain] (aa 8-198) (according to UniProt)
GMPS ATP-PPase domain (aa 199-388) (according to UniProt)
Structure
[PDB|2YWB] (from ''Thermus thermophilus hb8'', 45% identity, 57% similarity)
[AF|P29727]
Effectors of protein activity
the enzyme is inhibited by guanosine tetraphosphate ([wiki|stringent response]) [Pubmed|409404]
Additional information
belongs to the 100 most abundant proteins [PubMed|15378759]
Expression and Regulation
Operons
genes
[gene|AC67305E4C165CC1D785E49B7CD8335346134376|guaA]
description
[Pubmed|1312531]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|1312531], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Biological materials
Mutant
MGNA-A918 (yebB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/918 NBRP B. subtilis, Japan]
BKE06360 ([gene|AC67305E4C165CC1D785E49B7CD8335346134376|guaA]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE06360 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGTTGTCACCTAATCTC, downstream forward: _UP4_TAAGAATCAATTAATGGAAA
BKK06360 ([gene|AC67305E4C165CC1D785E49B7CD8335346134376|guaA]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK06360 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGTTGTCACCTAATCTC, downstream forward: _UP4_TAAGAATCAATTAATGGAAA
Expression vectors
pGP2898: expression of Strep-''guaA'' by [wiki|pGP380] in ''B. subtilis'' suitable for [wiki|SPINE], available in [wiki|Jörg Stülke]'s lab
References
Reviews
Original Publications
Page visits: 4396
Time of last update: 2025-10-24 10:21:36
Author of last update: Jstuelk