yerH

yerH
168

unknown lipoprotein

locus
BSU_06630
Molecular weight
44.36 kDa
pI
4.88
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yerH

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG4851

This gene is a member of the following regulons

Gene
Coordinates
723,635  724,825
The protein
Structure
[PDB|4HN3] (from Listeria monocytogenes, 45% identity)
[AF|O34629]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|0BA7EC658F5C2397A90B68AC234D04966966561C|pcrB]-[gene|C73E52D214E24F21696973B19B0A44CE785D6FBA|pcrA]-[gene|03EFF93C1B0CE075AE068ECC4EDE9BE5D03C857E|ligA]-[gene|ADAE6B5C301959D90592A6F26DFE1690BF6F5552|yerH]
description
[Pubmed|9701819]
regulation
induced by DNA damage ([protein|search|LexA]) [Pubmed|16267290]
regulatory mechanism
[protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|lexA]: repression, [Pubmed|16267290], in [regulon|protein:D267AF38B0CF107042326E9B8F3DD3C9C85840E4|lexA regulon]
Open in new tab

[gene|0BA7EC658F5C2397A90B68AC234D04966966561C|pcrB]→[gene|ADAE6B5C301959D90592A6F26DFE1690BF6F5552|yerH]

2022-06-23 17:47:02

ghost

35

dec907ab37dccb52bc69c4b0f73a394d7c7ee297

FEC0EF466BE2820083D3AF39105152A266EEF005

Biological materials
Mutant
MGNA-B445 (yerH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1444 NBRP B. subtilis, Japan]
BKE06630 ([gene|ADAE6B5C301959D90592A6F26DFE1690BF6F5552|yerH]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06630 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CTTTTTCAATAGAAAACACT,  downstream forward: _UP4_TGATAGAAAACCCTTGTGCC
BKK06630 ([gene|ADAE6B5C301959D90592A6F26DFE1690BF6F5552|yerH]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06630 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CTTTTTCAATAGAAAACACT,  downstream forward: _UP4_TGATAGAAAACCCTTGTGCC
References
16267290,9701819

ADAE6B5C301959D90592A6F26DFE1690BF6F5552

Page visits: 1441

Time of last update: 2022-06-27 04:05:43

Author of last update: Melvin.boenninger