rsbT

rsbT
168

PP2C activator, protein serine kinase, phosphorylates [protein|841CE7FCA4E84445830CA18F9856F6F30014E3BB|rsbS] and [protein|621357D1FB6AC1B0499732EFE226F982B26CE34E|rsbR], part of the [wiki|stressosome]

locus
BSU_04690
Molecular weight
14.21 kDa
pI
6.59
Protein length
Gene length
function
control of [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB] activity
product
PP2C activator, protein serine kinase
essential
no
synonyms
rsbT, ycxT

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2172

This gene is a member of the following regulons

Gene
Coordinates
520,606  521,007
The protein
Catalyzed reaction/ biological activity
phosphorylation of [protein|621357D1FB6AC1B0499732EFE226F982B26CE34E|rsbR], [protein|F53C527995909A1CFA72C7BF919DD10EE175C6D7|rsbRB], [protein|5EEEDE60CE9E5CDAEBAB0E03AABDF1DF62F1F002|rsbRC], and [protein|979D7A45EAD97C99015029400A85795061BAA367|rsbRD] [Pubmed|21362065]
ATP + L-seryl-[protein] --> ADP + H+ + O-phospho-L-seryl-[protein] (according to UniProt)
ATP + L-threonyl-[protein] --> ADP + H+ + O-phospho-L-threonyl-[protein] (according to UniProt)
Structure
[PDB|3VY9] (complete stressosome)
[AF|P42411]
Effectors of protein activity
phosphorylated [protein|621357D1FB6AC1B0499732EFE226F982B26CE34E|rsbR] activates the kinase activity of [protein|ADC52A22950736A0435AEEEC43F7407878786A81|rsbT] [Pubmed|23320651]
activity is stimulated by light in a [protein|6C5397BA5839E4DB25B370B39B6DA702147DA8B7|ytvA]-dependent manner [Pubmed|23416074]
Expression and Regulation
Operons
genes
[gene|621357D1FB6AC1B0499732EFE226F982B26CE34E|rsbR]-[gene|841CE7FCA4E84445830CA18F9856F6F30014E3BB|rsbS]-[gene|ADC52A22950736A0435AEEEC43F7407878786A81|rsbT]-[gene|0B8381D2C724DAA724E4AFC67000F12AD112D13D|rsbU]-[gene|AC64DA463250A090A62E50901EFE653C8F963872|rsbV]-[gene|5AF5F199C5D92E13DE1C56E28948A557E3954CBF|rsbW]-[gene|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]-[gene|8536803BDFB58D43C52961931F609933E49E989D|rsbX]
description
[Pubmed|8002610]
regulation
''[protein|search|rsbV]:'' induced by stress ([protein|search|SigB]) [Pubmed|11544224]
regulatory mechanism
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|20454630], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|8002610], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|11544224], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
Open in new tab

[gene|621357D1FB6AC1B0499732EFE226F982B26CE34E|rsbR]→[gene|8536803BDFB58D43C52961931F609933E49E989D|rsbX]

2022-11-23 08:48:25

ghost

52

5f220975cc2493224a8aa0770ee2187c815a2127

3EFC8DC1AC54632D4F2AC30497749AB5CCA3A39F

Biological materials
Mutant
BKE04690 ([gene|ADC52A22950736A0435AEEEC43F7407878786A81|rsbT]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE04690 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TACACAGGATTGGTCGTTCA,  downstream forward: _UP4_TGGCTTCGGTAGGAGGTAAG
BKK04690 ([gene|ADC52A22950736A0435AEEEC43F7407878786A81|rsbT]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK04690 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TACACAGGATTGGTCGTTCA,  downstream forward: _UP4_TGGCTTCGGTAGGAGGTAAG
labs
[wiki|Bill Haldenwang], San Antonio, USA
[wiki|Chet Price], Davis, USA [http://foodscience.ucdavis.edu/price_lab/pricelab.html homepage]
[wiki|Rick Lewis], Newcastle, UK [http://www.ncl.ac.uk/camb/staff/profile/r.lewis homepage]
References
Reviews
19704888,16319496,20658979,28271471,33042030
Original Publications
8682789,8002610,8682769,9658013,17303566,9786195,15090521,10781545,15583165,8824586,10329124,16321960,8808936,15312768,11244072,15342582,20019076,12499568,12950928,16321960,8955331,18832644,24599254,23407164,23320651,21362065,23416074,21979936,27977677,28727759

ADC52A22950736A0435AEEEC43F7407878786A81

Page visits: 2486

Time of last update: 2022-11-27 10:00:55

Author of last update: Jstuelk