yczJ

yczJ
168

unknown

locus
BSU_04130
Molecular weight
11.08 kDa
pI
4.96
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yczJ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2329

This gene is a member of the following regulons

Gene
Coordinates
463,496  463,783
The protein
[wiki|Domains]
[wiki|ABM domain] (aa 2-92) (according to UniProt)
Structure
[PDB|3GZ7] (from Bordetella bronchiseptica, 33% identity)
[AF|O31484]
Expression and Regulation
Operons
genes
[gene|ADE7B8EC308F74E642E98AF911048AD03F869A3F|yczJ]
description
[pubmed|22383849]
Open in new tab

[gene|ADE7B8EC308F74E642E98AF911048AD03F869A3F|yczJ]

2022-11-29 01:00:40

Jstuelk

16

51d86585e38b0356f66bce6003a0861f1701946d

C21997FA60CE290CC5CD3DFF31D83A66B6538AF8

Biological materials
Mutant
BKE04130 ([gene|ADE7B8EC308F74E642E98AF911048AD03F869A3F|yczJ]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE04130 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGCTATCCCTTCTTTCTG,  downstream forward: _UP4_CATTTTCAGGATGTGTAATA
BKK04130 ([gene|ADE7B8EC308F74E642E98AF911048AD03F869A3F|yczJ]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK04130 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGCTATCCCTTCTTTCTG,  downstream forward: _UP4_CATTTTCAGGATGTGTAATA

ADE7B8EC308F74E642E98AF911048AD03F869A3F

Page visits: 763

Time of last update: 2022-11-30 18:42:13

Author of last update: Melvin.boenninger