sacP

sacP
168

sucrose permease of the [wiki|phosphotransferase systems|phosphotransferase system], EIIBC of the [category|SW.1.2.2|PTS], [category|SW.3.4.3|Trigger enzyme], control of [protein|6796E1C147AA21E919A42A953884DC24E182F430|sacT] activity

locus
BSU_38050
Molecular weight
49.29 kDa
pI
7.03
Protein length
Gene length
function
sucrose uptake and phosphorylation, control of [protein|6796E1C147AA21E919A42A953884DC24E182F430|sacT] activity
product
sucrose-specific [category|SW.1.2.2|PTS] permease, EIIBC component
essential
no
ec
2.7.1.69
synonyms
sacP, ipa-49d

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1264

This gene is a member of the following regulons

Gene
Coordinates
3,903,646  3,905,031
The protein
Protein family
[category|SW.1.2.2|PTS] permease, sucrose family [Pubmed|10627040]
[wiki|Domains]
[wiki|PTS EIIB domain] type-1 (aa 1-87) (according to UniProt)
[wiki|PTS EIIC domain] type-1 (aa 107-461) (according to UniProt)
Structure
[AF|P05306]
Paralogous protein(s)
[protein|BC568649A341B2E6341993EDA4BF52BDE18A3294|treP], [protein|531F132F7F6A878F1E1D56977B9898A14272349A|sacX], [protein|35E6C81BE481C3E57CF47B781580368C3AC15D83|bglP], [protein|178D5E2AA1225FE909E6F2B63B3595F5ABB8E7A2|murP]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|AE02C38397AA790E4B216BB6DBABFE907B984D05|sacP]-[gene|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA]-[gene|803ED978141A0E09F1F9CAECAB4BA839D480241F|ywdA]
description
[Pubmed|3100393]
regulation
induced by sucrose ([protein|search|SacT]) [Pubmed|2163394]
regulatory mechanism
[protein|6796E1C147AA21E919A42A953884DC24E182F430|sacT]: antitermination, via binding to a [wiki|RNA switch], in [regulon|protein:6796E1C147AA21E919A42A953884DC24E182F430|sacT regulon]
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|8702561], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|AE02C38397AA790E4B216BB6DBABFE907B984D05|sacP]→[gene|803ED978141A0E09F1F9CAECAB4BA839D480241F|ywdA]

2022-11-21 19:54:23

ghost

28

84ac6df24eedff839607263961d011c324b7f03e

98AC56561C7DAA3F5751178FDFB48FF02310E968

Biological materials
Mutant
BKE38050 ([gene|AE02C38397AA790E4B216BB6DBABFE907B984D05|sacP]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE38050 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTATTTCTCCCCCTTTT,  downstream forward: _UP4_AATGAGGATGAGGAGAGGAA
BKK38050 ([gene|AE02C38397AA790E4B216BB6DBABFE907B984D05|sacP]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK38050 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTATTTCTCCCCCTTTT,  downstream forward: _UP4_AATGAGGATGAGGAGAGGAA
Expression vectors
for expression, purification of the EIIB domain in ''E. coli'' with N-terminal His-tag, in [wiki|pWH844]: pGP429, available in [wiki|Jörg Stülke]'s lab
for expression, purification of the EIIB domain in ''E. coli'' with N-terminal His-tag and thrombin cleavage site, in [wiki|pGP570]: pGP436, available in [wiki|Jörg Stülke]'s lab
References
10627040,12107147,3122206,2163394,8702561,2120236,22900538,30038046

AE02C38397AA790E4B216BB6DBABFE907B984D05

Page visits: 2343

Time of last update: 2022-11-27 04:10:20

Author of last update: Melvin.boenninger