yndD

yndD
168

part of the [protein|AE28299B0F274B189DD90554A5A4F7B9A9479B60|yndD]-[protein|B14179D0EF5D3493E5CDB8E15378A5088B4FFD10|yndE]-[wiki|YndF] germinant receptor of unknown specificity

locus
BSU_17750
Molecular weight
57.84 kDa
pI
9.23
Protein length
Gene length
function
[category|SW.4.2.4|Germination]
product
part of the [protein|AE28299B0F274B189DD90554A5A4F7B9A9479B60|yndD]-[protein|B14179D0EF5D3493E5CDB8E15378A5088B4FFD10|yndE]-[protein|2211659780DEC3F4131B127E68EEF626534DF4BE|yndF] germinant receptor
essential
no
synonyms
yndD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5901

This gene is a member of the following regulons

Gene
Coordinates
1,907,494  1,909,056
The protein
Protein family
[wiki|GerABKA family] (according to UniProt)
Structure
[PDB|6O59] (from B. megaterium, corresponds to aa 37 ... 298, 37.4% identity) [pubmed|31113879]
[AF|O31808]
Paralogous protein(s)
[protein|EDB2F4C132211F01654F2A2ED3D220EC15CE6F22|gerKA], [protein|EEDE6A22E91992ABCA677CAB7917B7168C5CB868|gerAA], [protein|3368743E6E03792DB83A38A19989123304DF7560|gerBA], [protein|7CE0CAF27B1C0F507E783B8B80622270B00634FD|yfkQ]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|AE28299B0F274B189DD90554A5A4F7B9A9479B60|yndD]-[gene|B14179D0EF5D3493E5CDB8E15378A5088B4FFD10|yndE]-[gene|2211659780DEC3F4131B127E68EEF626534DF4BE|yndF]
description
[Pubmed|16497325]
regulation
expressed late during sporulation in the forespore ([protein|search|SigG]) [Pubmed|15699190,16497325]
sigma factors
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|15699190,16497325], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|AE28299B0F274B189DD90554A5A4F7B9A9479B60|yndD]→[gene|2211659780DEC3F4131B127E68EEF626534DF4BE|yndF]

2022-12-29 23:37:33

ghost

43

2475fc3f605374c7d03f837ccdb4b7cf919dd1e9

8FEE9610941E29EE00A37E1F39BFC210F89F0F5C

Biological materials
Mutant
MGNA-A022 (yndD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/22 NBRP B. subtilis, Japan]
BKE17750 ([gene|AE28299B0F274B189DD90554A5A4F7B9A9479B60|yndD]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE17750 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTGCACCTTCTTATACAT,  downstream forward: _UP4_TGATGAACTCGACAGGATGG
BKK17750 ([gene|AE28299B0F274B189DD90554A5A4F7B9A9479B60|yndD]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK17750 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTGCACCTTCTTATACAT,  downstream forward: _UP4_TGATGAACTCGACAGGATGG
References
15699190,16497325,10762253,31113879

AE28299B0F274B189DD90554A5A4F7B9A9479B60

Page visits: 2646

Time of last update: 2023-02-05 04:06:37

Author of last update: Jstuelk