ydbK

ydbK
168

similar to [wiki|ABC transporter] (membrane protein)

locus
BSU_04500
Molecular weight
27.64 kDa
pI
10.04
Protein length
Gene length
function
unknown
product
[wiki|ABC transporter] (membrane protein)
essential
no
synonyms
ydbK

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
503,854  504,594
The protein
Structure
[AF|P96606]
[wiki|Localization]
cell membrane (according to UniProt)
Biological materials
Mutant
MGNA-C118 (ydbK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2116 NBRP B. subtilis, Japan]
BKE04500 ([gene|AE61E6752DF0F681C6DEBB8CD0970C7CDDA6F78E|ydbK]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE04500 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATGTTCATTCCAAATTA,  downstream forward: _UP4_TAAAGGCAAGGAATGACATT
BKK04500 ([gene|AE61E6752DF0F681C6DEBB8CD0970C7CDDA6F78E|ydbK]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK04500 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATGTTCATTCCAAATTA,  downstream forward: _UP4_TAAAGGCAAGGAATGACATT
References
10092453

AE61E6752DF0F681C6DEBB8CD0970C7CDDA6F78E

Page visits: 932

Time of last update: 2022-11-26 17:43:24

Author of last update: Jstuelk