trpB

trpB
168

tryptophan synthase (beta subunit)

locus
BSU_22640
Molecular weight
43.42 kDa
pI
5.53
Protein length
Gene length
function
biosynthesis of tryptophan
product
tryptophan synthase (beta subunit)
essential
no
ec
4.2.1.20
synonyms
trpB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0133

This gene is a member of the following regulons

Gene
Coordinates
2,372,304 → 2,373,506
The protein
Catalyzed reaction/ biological activity
(1S,2R)-1-C-(indol-3-yl)glycerol 3-phosphate + L-serine --> D-glyceraldehyde 3-phosphate + H2O + L-tryptophan (according to UniProt)
Protein family
TrpB family (single member, according to UniProt)
[wiki|Cofactors]
PLP (according to UniProt)
Structure
[PDB|4NEG] (from Bacillus anthracis, 60% identity)
[AF|P07600]
Expression and Regulation
Operons
genes
[gene|48C33A96F3B446440D4D9A86AA07AA3BA244063D|trpE]-[gene|4CD2A930753175B7F533EA6B91478577CE80A29C|trpD]-[gene|0467447B10EE7C1FDF86022AB6FBDBABFD32A9E5|trpC]-[gene|C6872585F9BD3717A4F49E96F7684C4A5AD1760D|trpF]-[gene|AEB1F4E28C5B2AFC7FCF65721D4D1A70D6FC38EE|trpB]-[gene|155FE26C148F7022948DD7539533AB6876571862|trpA]
description
[Pubmed|21815947]
regulation
not expressed if tryptophan is available ([protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|mtrB]) [Pubmed|1551827]
the mRNA is substantially stabilized upon depletion of [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
the [wiki|RNA switch] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
regulatory mechanism
[protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|mtrB]: termination/antitermination, [pubmed|1551827], in [regulon|protein:E030E80134E9DED6ADBC73C7C7435024CDFD38B9|mtrB regulon]
Open in new tab

[gene|48C33A96F3B446440D4D9A86AA07AA3BA244063D|trpE]→[gene|155FE26C148F7022948DD7539533AB6876571862|trpA]

2022-11-27 04:01:30

Jstuelk

24

53eef6e8739e58d1bed57b78e584c86a2e6ff379

37D11B58C2266E362D5C193ADEA68D53F64A90E3

genes
[gene|48C33A96F3B446440D4D9A86AA07AA3BA244063D|trpE]-[gene|4CD2A930753175B7F533EA6B91478577CE80A29C|trpD]-[gene|0467447B10EE7C1FDF86022AB6FBDBABFD32A9E5|trpC]-[gene|C6872585F9BD3717A4F49E96F7684C4A5AD1760D|trpF]-[gene|AEB1F4E28C5B2AFC7FCF65721D4D1A70D6FC38EE|trpB]-[gene|155FE26C148F7022948DD7539533AB6876571862|trpA]-[gene|4D7D62B4CDA350DCDC04E6934B5E23ECE4C57870|hisC]-[gene|DEB8358CE34F80560BE91F036659EF2C67A19623|tyrA]-[gene|CA00DFB480CBDC8AC31559958EF8E97E1E9BD4E1|aroE]
description
[Pubmed|21815947]
regulation
not expressed if tryptophan is available ([protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|mtrB]) [Pubmed|1551827]
the mRNA is substantially stabilized upon depletion of [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
regulatory mechanism
[protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|mtrB]: termination/antitermination, [pubmed|1551827], in [regulon|protein:E030E80134E9DED6ADBC73C7C7435024CDFD38B9|mtrB regulon]
Open in new tab

[gene|48C33A96F3B446440D4D9A86AA07AA3BA244063D|trpE]→[gene|CA00DFB480CBDC8AC31559958EF8E97E1E9BD4E1|aroE]

2022-11-17 08:57:50

Jstuelk

29

a3b37416002f0f1e65847bd8d15ba18b53400752

AA88BDB7192FA5467301E36C102EEEBB21BEDA86

Biological materials
Mutant
BKE22640 (Δ[gene|AEB1F4E28C5B2AFC7FCF65721D4D1A70D6FC38EE|trpB]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE22640 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GCCAAAATCACCGTATCTGC,  downstream forward: _UP4_GTATTGGAAGAAGAGGTGAA
BKK22640 (Δ[gene|AEB1F4E28C5B2AFC7FCF65721D4D1A70D6FC38EE|trpB]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK22640 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GCCAAAATCACCGTATCTGC,  downstream forward: _UP4_GTATTGGAAGAAGAGGTGAA
References
Reviews
18486479,11893063,11163353,7900177,19387555,12859215,11395405,12966138
Original Publications
14976255,3924737,6436812,2422155,8419914,1551827,17507374,21815947,31871208

AEB1F4E28C5B2AFC7FCF65721D4D1A70D6FC38EE

Page visits: 1937

Time of last update: 2022-11-28 02:59:09

Author of last update: Jstuelk