phrF
Register now for Subtillery 2022, the International Online Meeting on Bacillus subtilis! It will be held from the 19th-22th of September.

phrF
168

response regulator aspartate phosphatase (RapF) regulator, antagonizes the RapF-ComA interaction

locus
BSU_37470
Molecular weight
4.07 kDa
pI
10.24
Protein length
Gene length
function
control of ComA activity
product
phosphatase (RapF) regulator
essential
no
ec
null
synonyms
phrF, ywhI

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
3,847,130 → 3,847,249
The protein
Catalyzed reaction/ biological activity
binds to [protein|1F860F4E66A3D503D5A97F17D4AB0504BEFE7F9D|rapF], this results in the inability of [protein|1F860F4E66A3D503D5A97F17D4AB0504BEFE7F9D|rapF] to interact with [protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|comA] [Pubmed|15968044]
Protein family
[wiki|phr family] (according to UniProt)
Structure
[AF|P71001]
Expression and Regulation
Operons
genes
[gene|1F860F4E66A3D503D5A97F17D4AB0504BEFE7F9D|rapF]-[gene|AEBEDF43C56A9A54716D781D062067B69818FAF4|phrF]
description
[Pubmed|11466295]
regulation
PhrF accumulates at high cell density
regulatory mechanism
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|12850135], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
[protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|comA]: activation, [Pubmed|15968044], in [regulon|protein:7832489F11F606BCF637EC23BAAB41AD10237EBB|comA regulon]
sigma factors
[protein|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|sigH]: sigma factor, [Pubmed|11466295], in [regulon|protein:DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|sigH regulon]
Open in new tab

[gene|1F860F4E66A3D503D5A97F17D4AB0504BEFE7F9D|rapF]→[gene|AEBEDF43C56A9A54716D781D062067B69818FAF4|phrF]

2022-06-01 02:16:08

ghost

20

caaf58cf3ca24000725b4e5af0da77551dda5a5a

010F63D4BF5DE15B6446EA3923DABA1AD5BB01DD

genes
[gene|AEBEDF43C56A9A54716D781D062067B69818FAF4|phrF]
description
[Pubmed|11466295]
regulation
PhrF accumulates at high cell density
Open in new tab

[gene|AEBEDF43C56A9A54716D781D062067B69818FAF4|phrF]

2022-04-07 23:21:14

ghost

5

3a465f6b86242be8dd89892b04f668d99c079a03

4630C094A8458FABE37D63FB2F26BC7230337DE1

Biological materials
Mutant
BKE37470 (Δ[gene|AEBEDF43C56A9A54716D781D062067B69818FAF4|phrF]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37470 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TAGAGCCAGACAAGAGAGTA,  downstream forward: _UP4_TAACCGCCGTCCATCGGCGG
BKK37470 (Δ[gene|AEBEDF43C56A9A54716D781D062067B69818FAF4|phrF]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37470 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TAGAGCCAGACAAGAGAGTA,  downstream forward: _UP4_TAACCGCCGTCCATCGGCGG
References
16816200,15968044,11466295,16091051,22215984

AEBEDF43C56A9A54716D781D062067B69818FAF4

Page visits: 1641

Time of last update: 2022-08-09 00:19:27

Author of last update: Melvin.boenninger