yclG

yclG
168

unknown

locus
BSU_03680
Molecular weight
62.63 kDa
pI
5.22
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
yclG

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
417,993 → 419,747
The protein
Structure
[PDB|3ZPP] (from Streptococcus pneumoniae, corresponds to aa 6 ... 273, 23% identity) [pubmed|23894284]
[AF|P94409]
Expression and Regulation
Operons
genes
[gene|AEF2675431313A0BEE7C10200BA87281F91E2E19|yclG]
description
[pubmed|22383849]
Open in new tab

[gene|AEF2675431313A0BEE7C10200BA87281F91E2E19|yclG]

2022-11-30 19:12:53

Jstuelk

14

d7171b0c010933987c02f73a88f11758ecc1d047

7003D661662A71D3C4A79F28414C44A36F9C8B70

Biological materials
Mutant
MGNA-C064 (yclG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2062 NBRP B. subtilis, Japan]
BKE03680 (Δ[gene|AEF2675431313A0BEE7C10200BA87281F91E2E19|yclG]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE03680 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATTGCGAGCCTCCTTCTC,  downstream forward: _UP4_ATTGTCTGAAAAAAGCGCCC
BKK03680 (Δ[gene|AEF2675431313A0BEE7C10200BA87281F91E2E19|yclG]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK03680 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATTGCGAGCCTCCTTCTC,  downstream forward: _UP4_ATTGTCTGAAAAAAGCGCCC
References
Research papers
23894284

AEF2675431313A0BEE7C10200BA87281F91E2E19

Page visits: 1008

Time of last update: 2022-11-27 03:23:25

Author of last update: Jstuelk