sspD

sspD
168

small acid-soluble spore protein (minor alpha/beta-type SASP)

locus
BSU_13470
Molecular weight
6.67 kDa
pI
8.94
Protein length
Gene length
function
protection of spore DNA
product
small acid-soluble spore protein (minor alpha/beta-type SASP)
essential
no
synonyms
sspD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5852

This gene is a member of the following regulons

Gene
Coordinates
1,413,800 → 1,413,994
The protein
Protein family
[wiki|Alpha/beta-type SASP family] (according to UniProt)
Structure
[PDB|2Z3X] ([protein|9E1B3A6289F2C94F9088FA14CE8939E208DE9FEA|sspC]-DNA complex, 59% identity)
[AF|P04833]
Paralogous protein(s)
[protein|80B5DAED9B4BD015D877DB4819AB25FC5F165C6D|sspA], [protein|28F47ADECD376494878AE58B395B3A2616B6B5DF|sspB], [protein|9E1B3A6289F2C94F9088FA14CE8939E208DE9FEA|sspC]
Expression and Regulation
Operons
genes
[gene|AEFA4CE1588C7EC7FCB01312A172093D12B2B206|sspD]
description
[Pubmed|3009398]
regulation
expressed during sporulation in the forespore ([protein|search|SigG], [wiki|SpoVT]) [Pubmed|15699190,8755877]
regulatory mechanism
[protein|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|spoVT]: activation, [Pubmed|8755877], in [regulon|protein:01EF886D3D004EA9B22AC5E75D50FF07D8631E68|spoVT regulon]
sigma factors
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|15699190], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|AEFA4CE1588C7EC7FCB01312A172093D12B2B206|sspD]

2022-12-16 15:52:10

ghost

15

019b47640009cc6a8dd81591f577120425534b0a

8DD684E8E7ACB0135E7E792CA31D968305766E63

Biological materials
Mutant
BKE13470 (Δ[gene|AEFA4CE1588C7EC7FCB01312A172093D12B2B206|sspD]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE13470 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTTTTTCATCTCCTTTT,  downstream forward: _UP4_GGCACAACTAAATAAATTCA
BKK13470 (Δ[gene|AEFA4CE1588C7EC7FCB01312A172093D12B2B206|sspD]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK13470 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTTTTTCATCTCCTTTT,  downstream forward: _UP4_GGCACAACTAAATAAATTCA
References
Reviews
35638784
Original Publications
3009398,15699190,8755877

AEFA4CE1588C7EC7FCB01312A172093D12B2B206

Page visits: 1856

Time of last update: 2023-02-07 17:00:58

Author of last update: Jstuelk