yhcV

yhcV
168

forespore-specific sporulation protein

locus
BSU_09230
Molecular weight
14.77 kDa
pI
5.01
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yhcV

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0517

This gene is a member of the following regulons

Gene
Coordinates
997,175 → 997,597
The protein
[wiki|Domains]
2 [wiki|CBS domain]s (aa 8-64, aa 72-127) (according to UniProt)
Structure
[PDB|4FRY] (protein from ''Burkholderia ambifaria'', 30% identity) [Pubmed|23382856]
[AF|P54606]
Paralogous protein(s)
[protein|8529D83560E934709B20CCF0B72251A74EC272BB|ylbB], (40%)
Additional information
The gene is annotated in KEGG as an ortholog of IMP dehydrogenase EC 1.1.1.205. No EC annotation is available in Swiss-Prot/MetaSwiss-Prot/MetaCyc.literature/experimental evidence supporting the annotation is available. [Pubmed|19935659]
Expression and Regulation
Operons
genes
[gene|AF3ED8916EA02A560EC8D47E4B1C911E871B9AB0|yhcV]
description
[Pubmed|12480901]
regulation
expressed during sporulation in the forespore ([protein|search|SigG]) [Pubmed|15699190,12480901,16497325]
sigma factors
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|15699190,12480901,16497325], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|AF3ED8916EA02A560EC8D47E4B1C911E871B9AB0|yhcV]

2023-02-04 21:45:14

ghost

17

d05189296f00c818e951c88570579fec963c65f9

75F33A2A8BFFD48DEBCD4E4C948ADB2879084747

additional information
the mRNA belongs to the 46 most abundant mRNA species in dormant spores [pubmed|30782632]
Biological materials
Mutant
MGNA-B474 (yhcV::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1473 NBRP B. subtilis, Japan]
BKE09230 (Δ[gene|AF3ED8916EA02A560EC8D47E4B1C911E871B9AB0|yhcV]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE09230 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTGTCAGCACCCCTTTCA,  downstream forward: _UP4_TAATAAGAAAGAGCTTGCAG
BKK09230 (Δ[gene|AF3ED8916EA02A560EC8D47E4B1C911E871B9AB0|yhcV]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK09230 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTGTCAGCACCCCTTTCA,  downstream forward: _UP4_TAATAAGAAAGAGCTTGCAG
Expression vectors
pGP2930 (N-terminal His-tag, purification from ''E. coli'', in [wiki|pWH844]), available in [wiki|Jörg Stülke]'s lab
References
15699190,12480901,16497325,23382856,30782632,35638784

AF3ED8916EA02A560EC8D47E4B1C911E871B9AB0

Page visits: 2664

Time of last update: 2023-02-05 18:05:47

Author of last update: Jstuelk