glcU

glcU
168

probable glucose uptake protein

locus
BSU_03920
Molecular weight
30.74 kDa
pI
10.67
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
glcU, ycxE

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG4975

This gene is a member of the following regulons

Gene
Coordinates
444,461 → 445,324
The protein
Protein family
GRP transporter (TC 2.A.7.5) family (single member, according to UniProt)
Structure
[AF|P40420]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|AF5180DE23ADBBA4B58EC5D61A8C3EE08701E88B|glcU]-[gene|CA4597C6253CCF7D7954686A30AF041808BDF8E5|gdh]
description
[Pubmed|3141376]
regulation
expressed during sporulation ([protein|search|SigG], [wiki|SpoVT]) [Pubmed|3141376,8755877]
regulatory mechanism
[protein|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|spoVT]: repression, [Pubmed|8755877], in [regulon|protein:01EF886D3D004EA9B22AC5E75D50FF07D8631E68|spoVT regulon]
sigma factors
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|3141376], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|AF5180DE23ADBBA4B58EC5D61A8C3EE08701E88B|glcU]→[gene|CA4597C6253CCF7D7954686A30AF041808BDF8E5|gdh]

2022-11-21 11:56:51

ghost

36

16e0c9c3bee64d8f63243f9c4e2bb309da425435

684036B04938AABA3E506CAD88A18F69D2A51153

Biological materials
Mutant
MGNA-C016 (ycxE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2014 NBRP B. subtilis, Japan]
BKE03920 (Δ[gene|AF5180DE23ADBBA4B58EC5D61A8C3EE08701E88B|glcU]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE03920 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTGTTGGGGAACCTTCTT,  downstream forward: _UP4_TCATAACAAATGGAGGAGGA
BKK03920 (Δ[gene|AF5180DE23ADBBA4B58EC5D61A8C3EE08701E88B|glcU]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK03920 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTGTTGGGGAACCTTCTT,  downstream forward: _UP4_TCATAACAAATGGAGGAGGA
References
3141376,8755877,27766092,29512378

AF5180DE23ADBBA4B58EC5D61A8C3EE08701E88B

Page visits: 2022

Time of last update: 2022-12-01 09:50:24

Author of last update: Jstuelk