

diadenylate cyclase, synthesis of c-di-AMP in vegetative cells

Molecular weight
30.42 kDa
Protein length
Gene length
synthesis of c-di-AMP
diadenylate cyclase
cdaA, ybbP, ybbQ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1624

This gene is a member of the following regulons

196,213 → 197,034
Phenotypes of a mutant
inactivation of ''[gene|AFE2A9998219162FE32E95628B3CA9071099B61A|cdaA]'' results in severe beta-lactam sensitivity [Pubmed|22211522]
a [gene|AFE2A9998219162FE32E95628B3CA9071099B61A|cdaA] [gene|2B091CCEE9E34D659771E39B1FC9050A145048AB|disA] double mutant or [gene|AFE2A9998219162FE32E95628B3CA9071099B61A|cdaA] [gene|92EF98B872C1AD729B0BFAD46D3FA572E9C2AA32|cdaS] [gene|2B091CCEE9E34D659771E39B1FC9050A145048AB|disA] triple mutant is not viable on complex medium; however, the mutant grows at low potassium concentration (0.1 mM) [pubmed|28420751]
increased spontaneous mutagenesis [pubmed|36613897]
The protein
Catalyzed reaction/ biological activity
synthesis of c-di-AMP from two molecules of ATP [Pubmed|23192352]
2 ATP --> c-di-AMP + 2 diphosphate (according to UniProt)
Protein family
adenylate cyclase family (with [protein|92EF98B872C1AD729B0BFAD46D3FA572E9C2AA32|cdaS], according to UniProt)
contains a [wiki|DAC domain] involved in the synthesis of c-di-AMP [Pubmed|21566650]
[wiki|DAC domain] (aa 82-242) (according to UniProt)
Mn2+ [pubmed|31118276,25605729]
[PDB|6HUW] (the [wiki|DAC domain])
[PDB|7OLH], [PDB|7OJS] (complex of the [protein|AFE2A9998219162FE32E95628B3CA9071099B61A|cdaA] [wiki|DAC domain] and [protein|F022ACB2CBB8DA46B392CE1D26474093645F26DA|glmM])
[PDB|4RV7] (the [wiki|DAC domain] and C-terminal domain of CdaA from ''Listeria monocytogenes'' (aa 101 - 273), 65% identity) [Pubmed|25605729]
[PDB|6HVL] (the [wiki|DAC domain] and C-terminal domain of CdaA from ''Listeria monocytogenes'' (aa 101 - 273) in complex with c-di-AMP, 65% identity) [Pubmed|31118276]
Effectors of protein activity
the interaction with [protein|FB23F2AB0E2A82658009D115E5876E7AF1BDE5FD|cdaR] controls the diadenylate cyclase activity of [protein|AFE2A9998219162FE32E95628B3CA9071099B61A|cdaA] [Pubmed|23192352]
the interaction with [protein|FB23F2AB0E2A82658009D115E5876E7AF1BDE5FD|cdaR] inhibits the diadenylate cyclase activity of [protein|AFE2A9998219162FE32E95628B3CA9071099B61A|cdaA] (shown in S. aureus) [pubmed|30668586]
the interaction with [protein|F022ACB2CBB8DA46B392CE1D26474093645F26DA|glmM] inhibits the diadenylate cyclase activity of [protein|AFE2A9998219162FE32E95628B3CA9071099B61A|cdaA] ([pubmed|34678313]) under conditions of osmotic stress (shown in L. monocytogenes) [pubmed|32250026]
Paralogous protein(s)
cell membrane [Pubmed|26240071]
Expression and Regulation
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|22211522], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab


2023-01-30 22:54:36





additional information
CdaA levels are increased at increased potassium concentrations [pubmed|28420751]
the mRNA is very stable (> 15 min) [pubmed|12884008]
Biological materials
GP94 Δ[gene|AFE2A9998219162FE32E95628B3CA9071099B61A|cdaA]::spec, available in [wiki|Jörg Stülke]'s lab [pubmed|28420751]
GP997 Δ[gene|AFE2A9998219162FE32E95628B3CA9071099B61A|cdaA]::cat, available in [wiki|Jörg Stülke]'s lab [pubmed|23192352]
GP2790 Δ[gene|AFE2A9998219162FE32E95628B3CA9071099B61A|cdaA]::aphA3, available in [wiki|Jörg Stülke]'s lab
GP985 Δ[gene|AFE2A9998219162FE32E95628B3CA9071099B61A|cdaA]-[gene|FB23F2AB0E2A82658009D115E5876E7AF1BDE5FD|cdaR]::''cat'', available in [wiki|Jörg Stülke]'s lab [pubmed|23192352]
GP2222 [gene|AFE2A9998219162FE32E95628B3CA9071099B61A|cdaA]::cat [gene|92EF98B872C1AD729B0BFAD46D3FA572E9C2AA32|cdaS]::ermC ''[gene|2B091CCEE9E34D659771E39B1FC9050A145048AB|disA]''::''tet'', available in [wiki|Jörg Stülke]'s lab, the mutant is only viable on minimal medium at low potassium concentration [pubmed|28420751]
BKE01750 (Δ[gene|AFE2A9998219162FE32E95628B3CA9071099B61A|cdaA]::erm  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTCCTCGTCCTCCAAGA,  downstream forward: _UP4_CGCTGGTATTGGAGGGGCAA
BKK01750 (Δ[gene|AFE2A9998219162FE32E95628B3CA9071099B61A|cdaA]::kan  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTCCTCGTCCTCCAAGA,  downstream forward: _UP4_CGCTGGTATTGGAGGGGCAA
Expression vectors
expression of native ''cdaA'' in ''B. subtilis'': pGP1960 (in [wiki|pBQ200]), available in [wiki|Jörg Stülke]'s lab
expression of ''cdaA''-Strep in ''B. subtilis'' suitable for [wiki|SPINE]: pGP1986 (in [wiki|pGP382]), available in [wiki|Jörg Stülke]'s lab
IPTG inducible expression of ''cdaA''-Strep in ''E. coli'': pGP2564 (in [wiki|pGP574]), available in [wiki|Jörg Stülke]'s lab
IPTG inducible expression of His-''cdaA'' in ''E. coli'': pGP1970 (in pET19B), available in [wiki|Jörg Stülke]'s lab [pubmed|23192352]
two-hybrid system
B. pertussis adenylate cyclase-based bacterial two hybrid system ([wiki|BACTH]), available in [wiki|Jörg Stülke]'s lab. Respective plasmid: pGP1990 [pubmed|23192352]
FLAG-tag construct
GP1381 ''cdaA-3xFLAG ermC'' (based on [wiki|pGP1087]), available in [wiki|Jörg Stülke]'s lab [pubmed|28420751]
lacZ fusion
GP1339 (cat) based on [wiki|pAC6], available in [wiki|Jörg Stülke]'s lab [pubmed|23192352]
[wiki|Jörg Stülke], University of Göttingen, Germany [ Homepage]
Original Publications


Page visits: 4577

Time of last update: 2023-02-06 17:43:18

Author of last update: Jstuelk