yxxF

yxxF
168

unknown

locus
BSU_39240
Molecular weight
34.16 kDa
pI
7.96
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
yxxF

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0697

This gene is a member of the following regulons

Gene
Coordinates
4,030,710 → 4,031,645
The protein
Protein family
[wiki|EamA transporter family] (according to UniProt)
[wiki|Domains]
2 [wiki|EamA domain]s (aa 24-147, aa 166-292) (according to UniProt)
Structure
[AF|Q07835]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|AFED0CECAD2F9948049612CE8BC890938A0857FB|yxxF]
description
[Pubmed|10746760]
Open in new tab

[gene|AFED0CECAD2F9948049612CE8BC890938A0857FB|yxxF]

2022-06-25 13:24:53

ghost

9

77a8f5dd8c0cf1569813a3011d122361a82f6743

29EE142EB55EB9E365E9A2689B96AFCE132EFB66

Biological materials
Mutant
MGNA-B718 (yxxF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1717 NBRP B. subtilis, Japan]
BKE39240 (Δ[gene|AFED0CECAD2F9948049612CE8BC890938A0857FB|yxxF]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE39240 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCAAACGTATTCTACCTC,  downstream forward: _UP4_TAAAAAATGTAAAAAGGCCT
BKK39240 (Δ[gene|AFED0CECAD2F9948049612CE8BC890938A0857FB|yxxF]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK39240 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCAAACGTATTCTACCTC,  downstream forward: _UP4_TAAAAAATGTAAAAAGGCCT
References
10746760

AFED0CECAD2F9948049612CE8BC890938A0857FB

Page visits: 1228

Time of last update: 2022-06-21 12:26:03

Author of last update: Melvin.boenninger