SubtiWiki SubtiWiki

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!



Molecular weight
34.16 kDa
Protein length
Gene length

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0697

This gene is a member of the following regulons

4,030,710 → 4,031,645
The protein
Protein family
[wiki|EamA transporter family] (according to UniProt)
2 [wiki|EamA domain]s (aa 24-147, aa 166-292) (according to UniProt)
cell membrane (according to UniProt)
Expression and Regulation
Open in new tab


2021-12-13 22:12:18





Biological materials
MGNA-B718 (yxxF::erm), available at the [ NBRP B. subtilis, Japan]
BKE39240 (Δ[gene|AFED0CECAD2F9948049612CE8BC890938A0857FB|yxxF]::erm  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCAAACGTATTCTACCTC,  downstream forward: _UP4_TAAAAAATGTAAAAAGGCCT
BKK39240 (Δ[gene|AFED0CECAD2F9948049612CE8BC890938A0857FB|yxxF]::kan  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCAAACGTATTCTACCTC,  downstream forward: _UP4_TAAAAAATGTAAAAAGGCCT


Page visits: 1123

Time of last update: 2022-01-15 00:13:25

Author of last update: Melvin.boenninger