SubtiWiki SubtiWiki
natA

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

natA
168

Na+ [wiki|ABC transporter ](export) (ATP-binding protein)

locus
BSU_02750
Molecular weight
27.73 kDa
pI
8.8
Protein length
Gene length
function
sodium export
product
Na+ [wiki|ABC transporter ](export) (ATP-binding protein)
essential
no
synonyms
natA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG4555

This gene is a member of the following regulons

Gene
Coordinates
296,429 → 297,169
The protein
Catalyzed reaction/ biological activity
ATP + H2O + Na+ --> ADP + H+ + Na+ + phosphate (according to UniProt)
Protein family
[wiki|ABC transporter superfamily] (according to UniProt)
[wiki|Domains]
[wiki|ABC transporter domain] (aa 2-237) (according to UniProt)
Structure
[PDB|1VPL] (from Thermotoga maritima, 38% identity)
[wiki|Localization]
membrane associated (via [protein|A8ADA02BBB549866DE330040CF6D06ECC3B00099|natB]) [Pubmed|10092453]
Expression and Regulation
Operons
genes
[gene|B019FD0CB6F76C03DA5E76ABD1B324BA5E1A6936|natA]-[gene|A8ADA02BBB549866DE330040CF6D06ECC3B00099|natB]
description
[Pubmed|17322186]
regulatory mechanism
[protein|D3F6337B94A633730E514B05CA852BE9AA3741B3|natR]: activation, [Pubmed|17322186], in [regulon|protein:D3F6337B94A633730E514B05CA852BE9AA3741B3|natR regulon]
Open in new tab

[gene|B019FD0CB6F76C03DA5E76ABD1B324BA5E1A6936|natA]→[gene|A8ADA02BBB549866DE330040CF6D06ECC3B00099|natB]

2021-11-11 04:25:07

ghost

7

365bfdb79b01dbb624afc5261083cda7660bdab3

BD242E7EBA4710744BAD394FCF2B70F2317320EA

Biological materials
Mutant
BKE02750 (Δ[gene|B019FD0CB6F76C03DA5E76ABD1B324BA5E1A6936|natA]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02750 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTCACAATCTCCCTTAT,  downstream forward: _UP4_AAGCTTGTCAGGGGGATTTC
BKK02750 (Δ[gene|B019FD0CB6F76C03DA5E76ABD1B324BA5E1A6936|natA]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02750 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTCACAATCTCCCTTAT,  downstream forward: _UP4_AAGCTTGTCAGGGGGATTTC
References
9106203,10092453,17322186

B019FD0CB6F76C03DA5E76ABD1B324BA5E1A6936

Page visits: 1235

Time of last update: 2022-01-25 14:28:57

Author of last update: Melvin.boenninger